Incidental Mutation 'R8393:Capn10'
ID647453
Institutional Source Beutler Lab
Gene Symbol Capn10
Ensembl Gene ENSMUSG00000026270
Gene Namecalpain 10
SynonymsCapn8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R8393 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location92934376-92947941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92943408 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 313 (D313E)
Ref Sequence ENSEMBL: ENSMUSP00000027488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027488] [ENSMUST00000117814] [ENSMUST00000152983]
Predicted Effect probably benign
Transcript: ENSMUST00000027488
AA Change: D313E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027488
Gene: ENSMUSG00000026270
AA Change: D313E

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.05e-60 SMART
calpain_III 507 645 1.3e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117814
SMART Domains Protein: ENSMUSP00000112831
Gene: ENSMUSG00000026270

DomainStartEndE-ValueType
CysPc 2 263 1.29e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152983
AA Change: D313E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122158
Gene: ENSMUSG00000026270
AA Change: D313E

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.71e-60 SMART
low complexity region 490 499 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to ryanodine- and palmitate-induced pancreatic apoptosis. Mice homozygous for a different knock-out allele exhibit increased adiposity, body and organ weights, and leptin serum levels on background containing LG/J. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,500 T1015S possibly damaging Het
Acot11 T C 4: 106,760,193 T239A probably benign Het
Adgrg7 A G 16: 56,762,114 S258P probably damaging Het
Caprin2 A G 6: 148,869,152 V448A probably benign Het
Casr A G 16: 36,510,204 V256A probably benign Het
Cped1 A G 6: 22,222,466 T742A possibly damaging Het
Cyp2c39 G T 19: 39,536,811 R186L possibly damaging Het
Dazl A T 17: 50,281,266 S294T probably benign Het
Dnah17 C A 11: 118,057,029 V2982F probably damaging Het
Enpp3 C A 10: 24,826,241 C71F probably damaging Het
Fam234a A G 17: 26,218,175 C177R probably damaging Het
Fbxl5 A C 5: 43,768,091 Y186D possibly damaging Het
Fbxo43 T C 15: 36,162,348 T238A probably benign Het
Fcgbp A G 7: 28,107,390 H2261R probably benign Het
Gm20939 C T 17: 94,875,779 H148Y probably damaging Het
Gm21671 A T 5: 25,953,078 V92E probably damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Gpr45 C A 1: 43,032,235 H13N probably benign Het
Irf4 A G 13: 30,763,627 D438G probably damaging Het
Kcnk1 T C 8: 126,025,225 V190A probably benign Het
Klre1 A T 6: 129,580,062 K42N probably damaging Het
Lmbrd2 C T 15: 9,178,350 T499M probably damaging Het
Lrrc14 G T 15: 76,714,198 G345C probably damaging Het
Matn2 A G 15: 34,355,602 H251R possibly damaging Het
Mpnd A G 17: 56,016,568 E477G probably damaging Het
Muc3 C T 5: 137,142,331 V151I Het
Nckap5l A C 15: 99,427,169 C484W probably damaging Het
Npas1 C T 7: 16,461,341 S354N probably damaging Het
Olfr1131 T C 2: 87,628,853 L14P probably damaging Het
Olfr384 T C 11: 73,603,435 L285P probably damaging Het
Olfr594 T C 7: 103,220,192 V158A probably benign Het
Olfr597 A T 7: 103,320,461 I17F Het
Olfr730 C A 14: 50,186,885 E112* probably null Het
Olfr808 G T 10: 129,768,435 *313L probably null Het
Olfr985 T A 9: 40,127,064 H299L probably benign Het
Pabpc6 G A 17: 9,668,506 P372L probably damaging Het
Pkd1 A G 17: 24,572,647 N1103D probably damaging Het
Prelid2 C T 18: 41,881,248 C171Y probably benign Het
R3hcc1 T C 14: 69,705,441 Q229R probably benign Het
Rapgef6 T C 11: 54,687,661 V1003A probably benign Het
Rbp3 T A 14: 33,956,199 H701Q possibly damaging Het
Rmdn2 T C 17: 79,668,030 probably null Het
Robo2 A T 16: 73,978,494 W451R probably damaging Het
Sacs T A 14: 61,173,206 M1K probably null Het
Senp2 G A 16: 22,032,114 G294R probably damaging Het
Setdb2 T A 14: 59,412,731 H478L probably benign Het
Slc12a4 G T 8: 105,951,819 A295E probably damaging Het
Slc12a9 C T 5: 137,321,436 V606M probably damaging Het
Slc25a30 T C 14: 75,775,011 K66E probably benign Het
Slc39a6 T C 18: 24,599,274 E319G possibly damaging Het
Sorbs3 T A 14: 70,184,911 T617S probably benign Het
Spef2 T G 15: 9,676,529 D652A probably benign Het
Stag3 T C 5: 138,296,755 M347T probably damaging Het
Tecpr2 A T 12: 110,944,757 D1076V probably damaging Het
Tor2a G A 2: 32,761,636 V288I probably benign Het
Usp30 C T 5: 114,121,765 R511* probably null Het
Vezt T C 10: 93,996,842 T236A probably damaging Het
Zmynd12 A T 4: 119,448,155 D264V probably damaging Het
Other mutations in Capn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Capn10 APN 1 92942559 missense probably benign 0.00
IGL01071:Capn10 APN 1 92945075 missense probably damaging 1.00
IGL01682:Capn10 APN 1 92940384 missense probably benign 0.16
IGL01771:Capn10 APN 1 92940365 missense probably damaging 1.00
IGL02952:Capn10 APN 1 92945174 missense probably damaging 0.97
IGL03177:Capn10 APN 1 92934982 missense probably benign 0.02
IGL03224:Capn10 APN 1 92939324 missense probably damaging 1.00
P4717OSA:Capn10 UTSW 1 92939394 missense probably damaging 1.00
R1256:Capn10 UTSW 1 92946946 missense probably damaging 1.00
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1653:Capn10 UTSW 1 92946898 missense probably damaging 1.00
R1737:Capn10 UTSW 1 92934955 missense probably benign 0.10
R2127:Capn10 UTSW 1 92938034 nonsense probably null
R2433:Capn10 UTSW 1 92942525 missense probably benign 0.22
R2484:Capn10 UTSW 1 92944843 missense probably damaging 0.97
R4004:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4005:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4560:Capn10 UTSW 1 92939362 missense probably damaging 1.00
R4684:Capn10 UTSW 1 92943781 missense probably damaging 1.00
R4766:Capn10 UTSW 1 92943419 missense probably damaging 0.98
R4996:Capn10 UTSW 1 92945136 missense probably damaging 1.00
R5665:Capn10 UTSW 1 92937931 splice site probably null
R5733:Capn10 UTSW 1 92943913 missense probably benign 0.03
R5937:Capn10 UTSW 1 92939383 missense probably damaging 1.00
R6985:Capn10 UTSW 1 92943424 missense probably damaging 1.00
R7140:Capn10 UTSW 1 92945271 missense possibly damaging 0.85
R7495:Capn10 UTSW 1 92943370 missense probably damaging 1.00
R8170:Capn10 UTSW 1 92934964 missense probably damaging 0.98
R8943:Capn10 UTSW 1 92943732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAGTGTATGGCAAAAGTTTGAG -3'
(R):5'- AGACCAGTGGCAGTCAACTC -3'

Sequencing Primer
(F):5'- GCAAAAGTTTGAGGCTCTCC -3'
(R):5'- GGCAGTCAACTCACCCTCTG -3'
Posted On2020-09-02