Incidental Mutation 'R8393:Capn10'
ID 647453
Institutional Source Beutler Lab
Gene Symbol Capn10
Ensembl Gene ENSMUSG00000026270
Gene Name calpain 10
Synonyms Capn8
MMRRC Submission 067811-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R8393 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 92862130-92875670 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 92871130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 313 (D313E)
Ref Sequence ENSEMBL: ENSMUSP00000027488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027488] [ENSMUST00000117814] [ENSMUST00000152983]
AlphaFold Q9ESK3
Predicted Effect probably benign
Transcript: ENSMUST00000027488
AA Change: D313E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027488
Gene: ENSMUSG00000026270
AA Change: D313E

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.05e-60 SMART
calpain_III 507 645 1.3e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117814
SMART Domains Protein: ENSMUSP00000112831
Gene: ENSMUSG00000026270

DomainStartEndE-ValueType
CysPc 2 263 1.29e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152983
AA Change: D313E

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122158
Gene: ENSMUSG00000026270
AA Change: D313E

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.71e-60 SMART
low complexity region 490 499 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to ryanodine- and palmitate-induced pancreatic apoptosis. Mice homozygous for a different knock-out allele exhibit increased adiposity, body and organ weights, and leptin serum levels on background containing LG/J. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,617,390 (GRCm39) T239A probably benign Het
Adgrg7 A G 16: 56,582,477 (GRCm39) S258P probably damaging Het
Caprin2 A G 6: 148,770,650 (GRCm39) V448A probably benign Het
Casr A G 16: 36,330,566 (GRCm39) V256A probably benign Het
Cped1 A G 6: 22,222,465 (GRCm39) T742A possibly damaging Het
Cyp2c39 G T 19: 39,525,255 (GRCm39) R186L possibly damaging Het
Dazl A T 17: 50,588,294 (GRCm39) S294T probably benign Het
Dnah17 C A 11: 117,947,855 (GRCm39) V2982F probably damaging Het
Enpp3 C A 10: 24,702,139 (GRCm39) C71F probably damaging Het
Fam234a A G 17: 26,437,149 (GRCm39) C177R probably damaging Het
Fbxl5 A C 5: 43,925,433 (GRCm39) Y186D possibly damaging Het
Fbxo43 T C 15: 36,162,494 (GRCm39) T238A probably benign Het
Fcgbp A G 7: 27,806,815 (GRCm39) H2261R probably benign Het
Gm20939 C T 17: 95,183,207 (GRCm39) H148Y probably damaging Het
Gpat4 GTGTT GT 8: 23,669,498 (GRCm39) probably benign Het
Gpr45 C A 1: 43,071,395 (GRCm39) H13N probably benign Het
Irf4 A G 13: 30,947,610 (GRCm39) D438G probably damaging Het
Kcnk1 T C 8: 126,751,964 (GRCm39) V190A probably benign Het
Klre1 A T 6: 129,557,025 (GRCm39) K42N probably damaging Het
Lmbrd2 C T 15: 9,178,437 (GRCm39) T499M probably damaging Het
Lrrc14 G T 15: 76,598,398 (GRCm39) G345C probably damaging Het
Matn2 A G 15: 34,355,748 (GRCm39) H251R possibly damaging Het
Mpnd A G 17: 56,323,568 (GRCm39) E477G probably damaging Het
Muc17 C T 5: 137,171,179 (GRCm39) V151I Het
Nckap5l A C 15: 99,325,050 (GRCm39) C484W probably damaging Het
Npas1 C T 7: 16,195,266 (GRCm39) S354N probably damaging Het
Or1e25 T C 11: 73,494,261 (GRCm39) L285P probably damaging Het
Or4k2 C A 14: 50,424,342 (GRCm39) E112* probably null Het
Or52ab2 A T 7: 102,969,668 (GRCm39) I17F Het
Or52e3 T C 7: 102,869,399 (GRCm39) V158A probably benign Het
Or5w11 T C 2: 87,459,197 (GRCm39) L14P probably damaging Het
Or6c65 G T 10: 129,604,304 (GRCm39) *313L probably null Het
Or8d4 T A 9: 40,038,360 (GRCm39) H299L probably benign Het
Pabpc6 G A 17: 9,887,435 (GRCm39) P372L probably damaging Het
Pkd1 A G 17: 24,791,621 (GRCm39) N1103D probably damaging Het
Prelid2 C T 18: 42,014,313 (GRCm39) C171Y probably benign Het
R3hcc1 T C 14: 69,942,890 (GRCm39) Q229R probably benign Het
Rapgef6 T C 11: 54,578,487 (GRCm39) V1003A probably benign Het
Rbp3 T A 14: 33,678,156 (GRCm39) H701Q possibly damaging Het
Resf1 A T 6: 149,229,998 (GRCm39) T1015S possibly damaging Het
Rmdn2 T C 17: 79,975,459 (GRCm39) probably null Het
Robo2 A T 16: 73,775,382 (GRCm39) W451R probably damaging Het
Sacs T A 14: 61,410,655 (GRCm39) M1K probably null Het
Senp2 G A 16: 21,850,864 (GRCm39) G294R probably damaging Het
Setdb2 T A 14: 59,650,180 (GRCm39) H478L probably benign Het
Slc12a4 G T 8: 106,678,451 (GRCm39) A295E probably damaging Het
Slc12a9 C T 5: 137,319,698 (GRCm39) V606M probably damaging Het
Slc25a30 T C 14: 76,012,451 (GRCm39) K66E probably benign Het
Slc39a6 T C 18: 24,732,331 (GRCm39) E319G possibly damaging Het
Sorbs3 T A 14: 70,422,360 (GRCm39) T617S probably benign Het
Speer4a3 A T 5: 26,158,076 (GRCm39) V92E probably damaging Het
Spef2 T G 15: 9,676,615 (GRCm39) D652A probably benign Het
Stag3 T C 5: 138,295,017 (GRCm39) M347T probably damaging Het
Tecpr2 A T 12: 110,911,191 (GRCm39) D1076V probably damaging Het
Tor2a G A 2: 32,651,648 (GRCm39) V288I probably benign Het
Usp30 C T 5: 114,259,826 (GRCm39) R511* probably null Het
Vezt T C 10: 93,832,704 (GRCm39) T236A probably damaging Het
Zmynd12 A T 4: 119,305,352 (GRCm39) D264V probably damaging Het
Other mutations in Capn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Capn10 APN 1 92,870,281 (GRCm39) missense probably benign 0.00
IGL01071:Capn10 APN 1 92,872,797 (GRCm39) missense probably damaging 1.00
IGL01682:Capn10 APN 1 92,868,106 (GRCm39) missense probably benign 0.16
IGL01771:Capn10 APN 1 92,868,087 (GRCm39) missense probably damaging 1.00
IGL02952:Capn10 APN 1 92,872,896 (GRCm39) missense probably damaging 0.97
IGL03177:Capn10 APN 1 92,862,704 (GRCm39) missense probably benign 0.02
IGL03224:Capn10 APN 1 92,867,046 (GRCm39) missense probably damaging 1.00
P4717OSA:Capn10 UTSW 1 92,867,116 (GRCm39) missense probably damaging 1.00
R1256:Capn10 UTSW 1 92,874,668 (GRCm39) missense probably damaging 1.00
R1405:Capn10 UTSW 1 92,872,744 (GRCm39) missense probably benign 0.34
R1405:Capn10 UTSW 1 92,872,744 (GRCm39) missense probably benign 0.34
R1653:Capn10 UTSW 1 92,874,620 (GRCm39) missense probably damaging 1.00
R1737:Capn10 UTSW 1 92,862,677 (GRCm39) missense probably benign 0.10
R2127:Capn10 UTSW 1 92,865,756 (GRCm39) nonsense probably null
R2433:Capn10 UTSW 1 92,870,247 (GRCm39) missense probably benign 0.22
R2484:Capn10 UTSW 1 92,872,565 (GRCm39) missense probably damaging 0.97
R4004:Capn10 UTSW 1 92,868,313 (GRCm39) missense probably damaging 0.98
R4005:Capn10 UTSW 1 92,868,313 (GRCm39) missense probably damaging 0.98
R4560:Capn10 UTSW 1 92,867,084 (GRCm39) missense probably damaging 1.00
R4684:Capn10 UTSW 1 92,871,503 (GRCm39) missense probably damaging 1.00
R4766:Capn10 UTSW 1 92,871,141 (GRCm39) missense probably damaging 0.98
R4996:Capn10 UTSW 1 92,872,858 (GRCm39) missense probably damaging 1.00
R5665:Capn10 UTSW 1 92,865,653 (GRCm39) splice site probably null
R5733:Capn10 UTSW 1 92,871,635 (GRCm39) missense probably benign 0.03
R5937:Capn10 UTSW 1 92,867,105 (GRCm39) missense probably damaging 1.00
R6985:Capn10 UTSW 1 92,871,146 (GRCm39) missense probably damaging 1.00
R7140:Capn10 UTSW 1 92,872,993 (GRCm39) missense possibly damaging 0.85
R7495:Capn10 UTSW 1 92,871,092 (GRCm39) missense probably damaging 1.00
R8170:Capn10 UTSW 1 92,862,686 (GRCm39) missense probably damaging 0.98
R8943:Capn10 UTSW 1 92,871,454 (GRCm39) missense probably damaging 1.00
R9303:Capn10 UTSW 1 92,871,665 (GRCm39) critical splice donor site probably null
R9305:Capn10 UTSW 1 92,871,665 (GRCm39) critical splice donor site probably null
R9655:Capn10 UTSW 1 92,867,111 (GRCm39) missense probably damaging 1.00
R9776:Capn10 UTSW 1 92,871,586 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTGCAGTGTATGGCAAAAGTTTGAG -3'
(R):5'- AGACCAGTGGCAGTCAACTC -3'

Sequencing Primer
(F):5'- GCAAAAGTTTGAGGCTCTCC -3'
(R):5'- GGCAGTCAACTCACCCTCTG -3'
Posted On 2020-09-02