Incidental Mutation 'R8393:Rapgef6'
ID 647479
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8393 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 54522847-54699285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54687661 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1003 (V1003A)
Ref Sequence ENSEMBL: ENSMUSP00000092114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
AA Change: V1003A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: V1003A

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101206
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
AA Change: V1011A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: V1011A

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136494
SMART Domains Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
low complexity region 47 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207429
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,500 T1015S possibly damaging Het
Acot11 T C 4: 106,760,193 T239A probably benign Het
Adgrg7 A G 16: 56,762,114 S258P probably damaging Het
Capn10 T A 1: 92,943,408 D313E probably benign Het
Caprin2 A G 6: 148,869,152 V448A probably benign Het
Casr A G 16: 36,510,204 V256A probably benign Het
Cped1 A G 6: 22,222,466 T742A possibly damaging Het
Cyp2c39 G T 19: 39,536,811 R186L possibly damaging Het
Dazl A T 17: 50,281,266 S294T probably benign Het
Dnah17 C A 11: 118,057,029 V2982F probably damaging Het
Enpp3 C A 10: 24,826,241 C71F probably damaging Het
Fam234a A G 17: 26,218,175 C177R probably damaging Het
Fbxl5 A C 5: 43,768,091 Y186D possibly damaging Het
Fbxo43 T C 15: 36,162,348 T238A probably benign Het
Fcgbp A G 7: 28,107,390 H2261R probably benign Het
Gm20939 C T 17: 94,875,779 H148Y probably damaging Het
Gm21671 A T 5: 25,953,078 V92E probably damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Gpr45 C A 1: 43,032,235 H13N probably benign Het
Irf4 A G 13: 30,763,627 D438G probably damaging Het
Kcnk1 T C 8: 126,025,225 V190A probably benign Het
Klre1 A T 6: 129,580,062 K42N probably damaging Het
Lmbrd2 C T 15: 9,178,350 T499M probably damaging Het
Lrrc14 G T 15: 76,714,198 G345C probably damaging Het
Matn2 A G 15: 34,355,602 H251R possibly damaging Het
Mpnd A G 17: 56,016,568 E477G probably damaging Het
Muc3 C T 5: 137,142,331 V151I Het
Nckap5l A C 15: 99,427,169 C484W probably damaging Het
Npas1 C T 7: 16,461,341 S354N probably damaging Het
Olfr1131 T C 2: 87,628,853 L14P probably damaging Het
Olfr384 T C 11: 73,603,435 L285P probably damaging Het
Olfr594 T C 7: 103,220,192 V158A probably benign Het
Olfr597 A T 7: 103,320,461 I17F Het
Olfr730 C A 14: 50,186,885 E112* probably null Het
Olfr808 G T 10: 129,768,435 *313L probably null Het
Olfr985 T A 9: 40,127,064 H299L probably benign Het
Pabpc6 G A 17: 9,668,506 P372L probably damaging Het
Pkd1 A G 17: 24,572,647 N1103D probably damaging Het
Prelid2 C T 18: 41,881,248 C171Y probably benign Het
R3hcc1 T C 14: 69,705,441 Q229R probably benign Het
Rbp3 T A 14: 33,956,199 H701Q possibly damaging Het
Rmdn2 T C 17: 79,668,030 probably null Het
Robo2 A T 16: 73,978,494 W451R probably damaging Het
Sacs T A 14: 61,173,206 M1K probably null Het
Senp2 G A 16: 22,032,114 G294R probably damaging Het
Setdb2 T A 14: 59,412,731 H478L probably benign Het
Slc12a4 G T 8: 105,951,819 A295E probably damaging Het
Slc12a9 C T 5: 137,321,436 V606M probably damaging Het
Slc25a30 T C 14: 75,775,011 K66E probably benign Het
Slc39a6 T C 18: 24,599,274 E319G possibly damaging Het
Sorbs3 T A 14: 70,184,911 T617S probably benign Het
Spef2 T G 15: 9,676,529 D652A probably benign Het
Stag3 T C 5: 138,296,755 M347T probably damaging Het
Tecpr2 A T 12: 110,944,757 D1076V probably damaging Het
Tor2a G A 2: 32,761,636 V288I probably benign Het
Usp30 C T 5: 114,121,765 R511* probably null Het
Vezt T C 10: 93,996,842 T236A probably damaging Het
Zmynd12 A T 4: 119,448,155 D264V probably damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 splice site probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 splice site probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54626723 missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54625958 missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54631301 nonsense probably null
R8465:Rapgef6 UTSW 11 54691482 missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54690237 missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54568469 missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54552874 critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54691566 nonsense probably null
R8921:Rapgef6 UTSW 11 54679239 missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54687841 missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54597086 nonsense probably null
R9354:Rapgef6 UTSW 11 54619923 missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54552858 missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54691343 missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54622363 missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54649271 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCCAAGCTAATTGTGACTAGTTG -3'
(R):5'- CTTGATTGTGATGTGCATCCTC -3'

Sequencing Primer
(F):5'- GAAAAGAATTAATTGACCATGTCAGG -3'
(R):5'- GTTGACTAGTCTCTCCCTTGAAAG -3'
Posted On 2020-09-02