Incidental Mutation 'R8393:Olfr384'
ID647480
Institutional Source Beutler Lab
Gene Symbol Olfr384
Ensembl Gene ENSMUSG00000060335
Gene Nameolfactory receptor 384
SynonymsOlfr386, GA_x6K02T2P1NL-3739520-3740032, GA_x6K02T2P1NL-3773152-3774090, MOR135-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R8393 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73598594-73605092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73603435 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 285 (L285P)
Ref Sequence ENSEMBL: ENSMUSP00000148997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072993] [ENSMUST00000214228]
Predicted Effect probably damaging
Transcript: ENSMUST00000072993
AA Change: L285P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072758
Gene: ENSMUSG00000060335
AA Change: L285P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.6e-9 PFAM
Pfam:7tm_1 41 290 1.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214228
AA Change: L285P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,500 T1015S possibly damaging Het
Acot11 T C 4: 106,760,193 T239A probably benign Het
Adgrg7 A G 16: 56,762,114 S258P probably damaging Het
Capn10 T A 1: 92,943,408 D313E probably benign Het
Caprin2 A G 6: 148,869,152 V448A probably benign Het
Casr A G 16: 36,510,204 V256A probably benign Het
Cped1 A G 6: 22,222,466 T742A possibly damaging Het
Cyp2c39 G T 19: 39,536,811 R186L possibly damaging Het
Dazl A T 17: 50,281,266 S294T probably benign Het
Dnah17 C A 11: 118,057,029 V2982F probably damaging Het
Enpp3 C A 10: 24,826,241 C71F probably damaging Het
Fam234a A G 17: 26,218,175 C177R probably damaging Het
Fbxl5 A C 5: 43,768,091 Y186D possibly damaging Het
Fbxo43 T C 15: 36,162,348 T238A probably benign Het
Fcgbp A G 7: 28,107,390 H2261R probably benign Het
Gm20939 C T 17: 94,875,779 H148Y probably damaging Het
Gm21671 A T 5: 25,953,078 V92E probably damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Gpr45 C A 1: 43,032,235 H13N probably benign Het
Irf4 A G 13: 30,763,627 D438G probably damaging Het
Kcnk1 T C 8: 126,025,225 V190A probably benign Het
Klre1 A T 6: 129,580,062 K42N probably damaging Het
Lmbrd2 C T 15: 9,178,350 T499M probably damaging Het
Lrrc14 G T 15: 76,714,198 G345C probably damaging Het
Matn2 A G 15: 34,355,602 H251R possibly damaging Het
Mpnd A G 17: 56,016,568 E477G probably damaging Het
Muc3 C T 5: 137,142,331 V151I Het
Nckap5l A C 15: 99,427,169 C484W probably damaging Het
Npas1 C T 7: 16,461,341 S354N probably damaging Het
Olfr1131 T C 2: 87,628,853 L14P probably damaging Het
Olfr594 T C 7: 103,220,192 V158A probably benign Het
Olfr597 A T 7: 103,320,461 I17F Het
Olfr730 C A 14: 50,186,885 E112* probably null Het
Olfr808 G T 10: 129,768,435 *313L probably null Het
Olfr985 T A 9: 40,127,064 H299L probably benign Het
Pabpc6 G A 17: 9,668,506 P372L probably damaging Het
Pkd1 A G 17: 24,572,647 N1103D probably damaging Het
Prelid2 C T 18: 41,881,248 C171Y probably benign Het
R3hcc1 T C 14: 69,705,441 Q229R probably benign Het
Rapgef6 T C 11: 54,687,661 V1003A probably benign Het
Rbp3 T A 14: 33,956,199 H701Q possibly damaging Het
Rmdn2 T C 17: 79,668,030 probably null Het
Robo2 A T 16: 73,978,494 W451R probably damaging Het
Sacs T A 14: 61,173,206 M1K probably null Het
Senp2 G A 16: 22,032,114 G294R probably damaging Het
Setdb2 T A 14: 59,412,731 H478L probably benign Het
Slc12a4 G T 8: 105,951,819 A295E probably damaging Het
Slc12a9 C T 5: 137,321,436 V606M probably damaging Het
Slc25a30 T C 14: 75,775,011 K66E probably benign Het
Slc39a6 T C 18: 24,599,274 E319G possibly damaging Het
Sorbs3 T A 14: 70,184,911 T617S probably benign Het
Spef2 T G 15: 9,676,529 D652A probably benign Het
Stag3 T C 5: 138,296,755 M347T probably damaging Het
Tecpr2 A T 12: 110,944,757 D1076V probably damaging Het
Tor2a G A 2: 32,761,636 V288I probably benign Het
Usp30 C T 5: 114,121,765 R511* probably null Het
Vezt T C 10: 93,996,842 T236A probably damaging Het
Zmynd12 A T 4: 119,448,155 D264V probably damaging Het
Other mutations in Olfr384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Olfr384 APN 11 73603230 missense probably damaging 1.00
IGL01767:Olfr384 APN 11 73603032 missense probably benign
IGL02296:Olfr384 APN 11 73602706 missense probably damaging 1.00
IGL02327:Olfr384 APN 11 73603155 missense probably damaging 1.00
IGL02740:Olfr384 APN 11 73602831 missense probably benign 0.41
H8562:Olfr384 UTSW 11 73603447 missense probably damaging 1.00
R0594:Olfr384 UTSW 11 73603392 missense probably benign 0.03
R2038:Olfr384 UTSW 11 73603413 missense probably damaging 1.00
R2127:Olfr384 UTSW 11 73602805 missense possibly damaging 0.78
R2844:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R2846:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R3877:Olfr384 UTSW 11 73603153 missense probably damaging 1.00
R4193:Olfr384 UTSW 11 73603417 missense probably damaging 1.00
R4433:Olfr384 UTSW 11 73602886 missense probably damaging 1.00
R4824:Olfr384 UTSW 11 73602600 missense possibly damaging 0.61
R4851:Olfr384 UTSW 11 73603057 missense probably damaging 1.00
R5285:Olfr384 UTSW 11 73602941 nonsense probably null
R5326:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5542:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5662:Olfr384 UTSW 11 73603179 missense probably benign 0.03
R6489:Olfr384 UTSW 11 73603439 missense probably damaging 1.00
R6770:Olfr384 UTSW 11 73602978 missense probably benign 0.04
R7131:Olfr384 UTSW 11 73602736 missense possibly damaging 0.78
R7313:Olfr384 UTSW 11 73602984 missense probably damaging 0.99
R7754:Olfr384 UTSW 11 73603506 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATACTGTGGTGCCATTCTTAC -3'
(R):5'- TCAGTGTATCTTATTGCAGGGATAC -3'

Sequencing Primer
(F):5'- ATGTACAAATTGTCTGCTCCATTC -3'
(R):5'- TGTATCTTATTGCAGGGATACATTTG -3'
Posted On2020-09-02