Incidental Mutation 'R8393:Rbp3'
ID647484
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R8393 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33956199 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 701 (H701Q)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035695
AA Change: H701Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: H701Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,500 T1015S possibly damaging Het
Acot11 T C 4: 106,760,193 T239A probably benign Het
Adgrg7 A G 16: 56,762,114 S258P probably damaging Het
Capn10 T A 1: 92,943,408 D313E probably benign Het
Caprin2 A G 6: 148,869,152 V448A probably benign Het
Casr A G 16: 36,510,204 V256A probably benign Het
Cped1 A G 6: 22,222,466 T742A possibly damaging Het
Cyp2c39 G T 19: 39,536,811 R186L possibly damaging Het
Dazl A T 17: 50,281,266 S294T probably benign Het
Dnah17 C A 11: 118,057,029 V2982F probably damaging Het
Enpp3 C A 10: 24,826,241 C71F probably damaging Het
Fam234a A G 17: 26,218,175 C177R probably damaging Het
Fbxl5 A C 5: 43,768,091 Y186D possibly damaging Het
Fbxo43 T C 15: 36,162,348 T238A probably benign Het
Fcgbp A G 7: 28,107,390 H2261R probably benign Het
Gm20939 C T 17: 94,875,779 H148Y probably damaging Het
Gm21671 A T 5: 25,953,078 V92E probably damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Gpr45 C A 1: 43,032,235 H13N probably benign Het
Irf4 A G 13: 30,763,627 D438G probably damaging Het
Kcnk1 T C 8: 126,025,225 V190A probably benign Het
Klre1 A T 6: 129,580,062 K42N probably damaging Het
Lmbrd2 C T 15: 9,178,350 T499M probably damaging Het
Lrrc14 G T 15: 76,714,198 G345C probably damaging Het
Matn2 A G 15: 34,355,602 H251R possibly damaging Het
Mpnd A G 17: 56,016,568 E477G probably damaging Het
Muc3 C T 5: 137,142,331 V151I Het
Nckap5l A C 15: 99,427,169 C484W probably damaging Het
Npas1 C T 7: 16,461,341 S354N probably damaging Het
Olfr1131 T C 2: 87,628,853 L14P probably damaging Het
Olfr384 T C 11: 73,603,435 L285P probably damaging Het
Olfr594 T C 7: 103,220,192 V158A probably benign Het
Olfr597 A T 7: 103,320,461 I17F Het
Olfr730 C A 14: 50,186,885 E112* probably null Het
Olfr808 G T 10: 129,768,435 *313L probably null Het
Olfr985 T A 9: 40,127,064 H299L probably benign Het
Pabpc6 G A 17: 9,668,506 P372L probably damaging Het
Pkd1 A G 17: 24,572,647 N1103D probably damaging Het
Prelid2 C T 18: 41,881,248 C171Y probably benign Het
R3hcc1 T C 14: 69,705,441 Q229R probably benign Het
Rapgef6 T C 11: 54,687,661 V1003A probably benign Het
Rmdn2 T C 17: 79,668,030 probably null Het
Robo2 A T 16: 73,978,494 W451R probably damaging Het
Sacs T A 14: 61,173,206 M1K probably null Het
Senp2 G A 16: 22,032,114 G294R probably damaging Het
Setdb2 T A 14: 59,412,731 H478L probably benign Het
Slc12a4 G T 8: 105,951,819 A295E probably damaging Het
Slc12a9 C T 5: 137,321,436 V606M probably damaging Het
Slc25a30 T C 14: 75,775,011 K66E probably benign Het
Slc39a6 T C 18: 24,599,274 E319G possibly damaging Het
Sorbs3 T A 14: 70,184,911 T617S probably benign Het
Spef2 T G 15: 9,676,529 D652A probably benign Het
Stag3 T C 5: 138,296,755 M347T probably damaging Het
Tecpr2 A T 12: 110,944,757 D1076V probably damaging Het
Tor2a G A 2: 32,761,636 V288I probably benign Het
Usp30 C T 5: 114,121,765 R511* probably null Het
Vezt T C 10: 93,996,842 T236A probably damaging Het
Zmynd12 A T 4: 119,448,155 D264V probably damaging Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7758:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
R7845:Rbp3 UTSW 14 33956464 missense probably benign 0.24
R8176:Rbp3 UTSW 14 33955648 missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33956363 missense probably benign 0.00
Z1177:Rbp3 UTSW 14 33954538 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGGACTTCCATCGCAGTCTG -3'
(R):5'- GTACTAGCTGAGGCCCAATG -3'

Sequencing Primer
(F):5'- CTTGGTAGAGGGCACGGGTC -3'
(R):5'- AATGGCCTTTACTGTCTCTAGCTCAG -3'
Posted On2020-09-02