Mutagenetix > Incidental Mutation

Incidental Mutation 'R8393:Setdb2'

647486

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R8393 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59412731 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 478 (H478L)

Ref Sequence

ENSEMBL: ENSMUSP00000124696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095775
AA Change: H494L

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: H494L

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161459
AA Change: H478L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: H478L

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,328,500	T1015S	possibly damaging	Het
Acot11	T	C	4: 106,760,193	T239A	probably benign	Het
Adgrg7	A	G	16: 56,762,114	S258P	probably damaging	Het
Capn10	T	A	1: 92,943,408	D313E	probably benign	Het
Caprin2	A	G	6: 148,869,152	V448A	probably benign	Het
Casr	A	G	16: 36,510,204	V256A	probably benign	Het
Cped1	A	G	6: 22,222,466	T742A	possibly damaging	Het
Cyp2c39	G	T	19: 39,536,811	R186L	possibly damaging	Het
Dazl	A	T	17: 50,281,266	S294T	probably benign	Het
Dnah17	C	A	11: 118,057,029	V2982F	probably damaging	Het
Enpp3	C	A	10: 24,826,241	C71F	probably damaging	Het
Fam234a	A	G	17: 26,218,175	C177R	probably damaging	Het
Fbxl5	A	C	5: 43,768,091	Y186D	possibly damaging	Het
Fbxo43	T	C	15: 36,162,348	T238A	probably benign	Het
Fcgbp	A	G	7: 28,107,390	H2261R	probably benign	Het
Gm20939	C	T	17: 94,875,779	H148Y	probably damaging	Het
Gm21671	A	T	5: 25,953,078	V92E	probably damaging	Het
Gpat4	GTGTT	GT	8: 23,179,482		probably benign	Het
Gpr45	C	A	1: 43,032,235	H13N	probably benign	Het
Irf4	A	G	13: 30,763,627	D438G	probably damaging	Het
Kcnk1	T	C	8: 126,025,225	V190A	probably benign	Het
Klre1	A	T	6: 129,580,062	K42N	probably damaging	Het
Lmbrd2	C	T	15: 9,178,350	T499M	probably damaging	Het
Lrrc14	G	T	15: 76,714,198	G345C	probably damaging	Het
Matn2	A	G	15: 34,355,602	H251R	possibly damaging	Het
Mpnd	A	G	17: 56,016,568	E477G	probably damaging	Het
Muc3	C	T	5: 137,142,331	V151I		Het
Nckap5l	A	C	15: 99,427,169	C484W	probably damaging	Het
Npas1	C	T	7: 16,461,341	S354N	probably damaging	Het
Olfr1131	T	C	2: 87,628,853	L14P	probably damaging	Het
Olfr384	T	C	11: 73,603,435	L285P	probably damaging	Het
Olfr594	T	C	7: 103,220,192	V158A	probably benign	Het
Olfr597	A	T	7: 103,320,461	I17F		Het
Olfr730	C	A	14: 50,186,885	E112*	probably null	Het
Olfr808	G	T	10: 129,768,435	*313L	probably null	Het
Olfr985	T	A	9: 40,127,064	H299L	probably benign	Het
Pabpc6	G	A	17: 9,668,506	P372L	probably damaging	Het
Pkd1	A	G	17: 24,572,647	N1103D	probably damaging	Het
Prelid2	C	T	18: 41,881,248	C171Y	probably benign	Het
R3hcc1	T	C	14: 69,705,441	Q229R	probably benign	Het
Rapgef6	T	C	11: 54,687,661	V1003A	probably benign	Het
Rbp3	T	A	14: 33,956,199	H701Q	possibly damaging	Het
Rmdn2	T	C	17: 79,668,030		probably null	Het
Robo2	A	T	16: 73,978,494	W451R	probably damaging	Het
Sacs	T	A	14: 61,173,206	M1K	probably null	Het
Senp2	G	A	16: 22,032,114	G294R	probably damaging	Het
Slc12a4	G	T	8: 105,951,819	A295E	probably damaging	Het
Slc12a9	C	T	5: 137,321,436	V606M	probably damaging	Het
Slc25a30	T	C	14: 75,775,011	K66E	probably benign	Het
Slc39a6	T	C	18: 24,599,274	E319G	possibly damaging	Het
Sorbs3	T	A	14: 70,184,911	T617S	probably benign	Het
Spef2	T	G	15: 9,676,529	D652A	probably benign	Het
Stag3	T	C	5: 138,296,755	M347T	probably damaging	Het
Tecpr2	A	T	12: 110,944,757	D1076V	probably damaging	Het
Tor2a	G	A	2: 32,761,636	V288I	probably benign	Het
Usp30	C	T	5: 114,121,765	R511*	probably null	Het
Vezt	T	C	10: 93,996,842	T236A	probably damaging	Het
Zmynd12	A	T	4: 119,448,155	D264V	probably damaging	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAATGGTTGATTTCCCTGGAG -3'
(R):5'- GTATCACCATTCTATTTGAAGCCC -3'

Sequencing Primer
(F):5'- GATTTCCCTGGAGAGGCATC -3'
(R):5'- ACCATGTCTTCTGGAAGAGC -3'

Posted On

2020-09-02