Incidental Mutation 'R0020:Ezr'
ID64750
Institutional Source Beutler Lab
Gene Symbol Ezr
Ensembl Gene ENSMUSG00000052397
Gene Nameezrin
Synonymscytovillin, Vil2, ezrin, p81
MMRRC Submission 038315-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0020 (G1)
Quality Score128
Status Validated
Chromosome17
Chromosomal Location6738041-6782784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6742727 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 308 (Q308K)
Ref Sequence ENSEMBL: ENSMUSP00000063734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064234] [ENSMUST00000097430] [ENSMUST00000159394] [ENSMUST00000159880] [ENSMUST00000160483] [ENSMUST00000161118] [ENSMUST00000162635]
Predicted Effect probably damaging
Transcript: ENSMUST00000064234
AA Change: Q308K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063734
Gene: ENSMUSG00000052397
AA Change: Q308K

DomainStartEndE-ValueType
B41 1 206 7.74e-79 SMART
FERM_C 210 299 1.34e-35 SMART
Pfam:ERM 338 586 2.3e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097430
SMART Domains Protein: ENSMUSP00000095041
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 6e-25 PFAM
low complexity region 162 170 N/A INTRINSIC
C2 321 426 9.17e-15 SMART
C2 478 601 1.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131131
Predicted Effect probably benign
Transcript: ENSMUST00000159394
SMART Domains Protein: ENSMUSP00000124146
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 3.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159880
SMART Domains Protein: ENSMUSP00000125469
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
C2 116 221 9.17e-15 SMART
C2 273 396 1.92e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160483
SMART Domains Protein: ENSMUSP00000123996
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
C2 126 231 9.17e-15 SMART
C2 283 406 1.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161118
Predicted Effect probably benign
Transcript: ENSMUST00000162635
SMART Domains Protein: ENSMUSP00000124496
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 4.3e-27 PFAM
low complexity region 158 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232362
Meta Mutation Damage Score 0.4027 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic peripheral membrane protein encoded by this gene functions as a protein-tyrosine kinase substrate in microvilli. As a member of the ERM protein family, this protein serves as an intermediate between the plasma membrane and the actin cytoskeleton. This protein plays a key role in cell surface structure adhesion, migration and organization, and it has been implicated in various human cancers. A pseudogene located on chromosome 3 has been identified for this gene. Alternatively spliced variants have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality with abnormal intestinal villi morphology. Mice homozygous for a knock-down allele exhibit growth retardation, partial postnatal lethality, achlorhydria, and abnormal gastric parietal cell morphology and response to histamine stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,197 D2032E probably damaging Het
Ado T C 10: 67,548,097 D226G probably benign Het
Agfg2 C T 5: 137,653,802 V432M probably benign Het
Atf2 T C 2: 73,846,284 D122G possibly damaging Het
AW549877 T C 15: 3,991,868 probably benign Het
C330027C09Rik A T 16: 49,001,612 H201L probably damaging Het
Cd2bp2 G A 7: 127,193,824 T342M probably damaging Het
Col6a3 T A 1: 90,811,550 I319F probably damaging Het
Cst11 T A 2: 148,771,333 Y24F probably damaging Het
Cstb T A 10: 78,427,336 V65E probably benign Het
Cyp2j11 G A 4: 96,307,404 H352Y probably benign Het
D130043K22Rik T A 13: 24,854,492 probably benign Het
Dbh A G 2: 27,170,572 probably benign Het
Dhdh T C 7: 45,488,104 K53R probably benign Het
Drc3 A G 11: 60,370,545 Y174C probably damaging Het
F3 A T 3: 121,731,616 N169Y probably damaging Het
Fbn2 G T 18: 58,105,164 T587K probably damaging Het
Fhl5 A T 4: 25,200,054 V260E probably benign Het
Glyr1 A G 16: 5,037,049 I55T probably damaging Het
Gm12695 G C 4: 96,769,735 P66A probably damaging Het
Gm6614 A T 6: 141,972,350 V600E possibly damaging Het
Gon4l G T 3: 88,858,937 V428L probably damaging Het
Grasp T C 15: 101,230,552 V157A probably damaging Het
Ighv6-5 T C 12: 114,416,621 D92G probably null Het
Inhba A C 13: 16,026,364 K170N possibly damaging Het
Kng2 A G 16: 22,997,296 V317A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Map3k14 T C 11: 103,227,674 E562G probably damaging Het
Megf10 G T 18: 57,287,893 V868F possibly damaging Het
Nap1l1 A C 10: 111,491,023 E148D probably benign Het
Nlrp4a A T 7: 26,450,372 H468L probably damaging Het
Nphs1 G T 7: 30,463,208 V357L probably benign Het
Olfr432 T A 1: 174,050,847 V158E probably damaging Het
Pclo A G 5: 14,669,673 T1275A unknown Het
Pde4d T A 13: 109,954,570 C35S possibly damaging Het
Pkd1l1 A G 11: 8,875,765 probably benign Het
Pkd2 A G 5: 104,503,516 E910G probably damaging Het
Pot1b T A 17: 55,653,429 M634L probably benign Het
Ppp2r5c C T 12: 110,574,823 Q469* probably null Het
Ppp6r2 T A 15: 89,259,139 M163K probably damaging Het
Prss43 C A 9: 110,828,512 probably benign Het
Rb1cc1 C A 1: 6,264,548 N1444K possibly damaging Het
Scube2 A G 7: 109,830,888 probably benign Het
Slamf9 T C 1: 172,475,515 S7P possibly damaging Het
Slc35b2 T A 17: 45,566,856 M303K probably damaging Het
Slc4a7 T A 14: 14,796,108 F1116I probably benign Het
Smarcad1 T A 6: 65,084,007 probably benign Het
Tns3 A C 11: 8,545,227 probably null Het
Zfp282 T G 6: 47,880,009 W59G probably damaging Het
Zfp746 C A 6: 48,064,707 A362S probably benign Het
Other mutations in Ezr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ezr APN 17 6742489 unclassified probably benign
IGL02871:Ezr APN 17 6742390 nonsense probably null
R0020:Ezr UTSW 17 6742727 missense probably damaging 1.00
R0277:Ezr UTSW 17 6754765 nonsense probably null
R0323:Ezr UTSW 17 6754765 nonsense probably null
R0930:Ezr UTSW 17 6753999 nonsense probably null
R1497:Ezr UTSW 17 6742708 missense probably benign 0.07
R1669:Ezr UTSW 17 6739313 missense probably damaging 1.00
R1801:Ezr UTSW 17 6742372 missense possibly damaging 0.62
R2078:Ezr UTSW 17 6782642 start codon destroyed probably null 0.23
R4250:Ezr UTSW 17 6754797 missense probably damaging 1.00
R4448:Ezr UTSW 17 6753074 missense probably benign 0.01
R4610:Ezr UTSW 17 6739722 missense possibly damaging 0.71
R4691:Ezr UTSW 17 6759562 missense probably benign
R4736:Ezr UTSW 17 6741576 missense probably benign 0.42
R5327:Ezr UTSW 17 6753049 missense probably damaging 1.00
R6564:Ezr UTSW 17 6742847 missense probably damaging 0.99
R7863:Ezr UTSW 17 6741464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCATAGCCTGTGTCTGTGTCC -3'
(R):5'- CGATAACCAGCTCTCTCAGTGCAAG -3'

Sequencing Primer
(F):5'- CCTGCTTGATCCCAACTGG -3'
(R):5'- GAGAAACTCTTATGAAGTGCCGTC -3'
Posted On2013-08-06