Incidental Mutation 'R8394:Efl1'
ID647528
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Nameelongation factor like GPTase 1
Synonyms6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R8394 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location82648614-82777852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82762778 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 792 (I792V)
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
Predicted Effect probably benign
Transcript: ENSMUST00000039881
AA Change: I792V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: I792V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
AA Change: I792V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: I792V

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,142,174 N137S probably benign Het
4930505A04Rik T A 11: 30,454,880 probably null Het
Abcc8 A G 7: 46,154,553 I399T probably benign Het
Aldh3b2 A C 19: 3,979,461 Q278P probably benign Het
Arl8b A G 6: 108,783,283 D10G possibly damaging Het
Baiap3 T C 17: 25,250,122 N229S probably benign Het
Chrdl2 T C 7: 100,017,085 S71P possibly damaging Het
Cmbl A G 15: 31,585,395 M142V possibly damaging Het
Cpt1b A G 15: 89,422,287 probably null Het
Crybg3 T C 16: 59,558,288 K868E probably benign Het
Evx2 A G 2: 74,655,977 L356S probably benign Het
Hspa14 C T 2: 3,512,633 probably null Het
Ighv5-8 C T 12: 113,655,193 A76V unknown Het
Il7r A G 15: 9,516,418 F99S probably damaging Het
Klra2 A T 6: 131,245,310 V6D possibly damaging Het
Lce3c T C 3: 92,945,453 S74P unknown Het
Nectin2 C T 7: 19,733,212 probably null Het
Nfil3 A G 13: 52,967,813 S352P probably benign Het
Nme6 T A 9: 109,835,326 M1K probably null Het
Olfr618 A T 7: 103,598,197 I294F probably damaging Het
Otogl A G 10: 107,886,465 probably null Het
Plcb1 T C 2: 135,317,790 V391A probably damaging Het
Ptf1a T A 2: 19,445,935 D25E probably damaging Het
Ralbp1 C T 17: 65,852,753 R505H probably benign Het
Scube1 T C 15: 83,608,291 Y944C probably damaging Het
Sdk2 A G 11: 113,838,716 I1039T probably benign Het
Senp7 G T 16: 56,169,827 W646L possibly damaging Het
Sphkap A T 1: 83,276,076 N1317K probably benign Het
Strc G T 2: 121,379,009 Q278K probably benign Het
Tbc1d30 T A 10: 121,347,108 R142* probably null Het
Tmtc3 T C 10: 100,446,946 I916V probably damaging Het
Tomm40l A T 1: 171,221,207 H79Q probably damaging Het
Txndc12 T A 4: 108,856,223 probably null Het
Vmn2r2 T C 3: 64,137,437 N96S probably damaging Het
Vmn2r27 T C 6: 124,191,817 T785A possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp462 A G 4: 55,011,862 D1276G probably damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R7969:Efl1 UTSW 7 82692970 missense probably benign 0.03
R8702:Efl1 UTSW 7 82750790 critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82762953 missense probably benign 0.03
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCGGATGGGCTTATCACC -3'
(R):5'- CTATTGCCAAAGTCTCGGAATC -3'

Sequencing Primer
(F):5'- GATGGGCTTATCACCATACCG -3'
(R):5'- AAAGTCTCGGAATCTGCTGGC -3'
Posted On2020-09-02