Incidental Mutation 'R0021:Brinp3'
ID64754
Institutional Source Beutler Lab
Gene Symbol Brinp3
Ensembl Gene ENSMUSG00000035131
Gene Namebone morphogenetic protein/retinoic acid inducible neural specific 3
SynonymsFam5c, B830045N13Rik
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0021 (G1)
Quality Score97
Status Validated
Chromosome1
Chromosomal Location146494760-146902472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 146901451 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 545 (S545R)
Ref Sequence ENSEMBL: ENSMUSP00000126074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]
Predicted Effect probably benign
Transcript: ENSMUST00000074622
AA Change: S545R

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: S545R

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128345
SMART Domains Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166814
AA Change: S545R

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: S545R

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Brinp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Brinp3 APN 1 146901774 missense probably damaging 0.99
IGL00503:Brinp3 APN 1 146901167 missense probably benign
IGL01702:Brinp3 APN 1 146751997 splice site probably benign
IGL01728:Brinp3 APN 1 146831551 splice site probably null
IGL01733:Brinp3 APN 1 146514803 missense probably benign 0.33
IGL01937:Brinp3 APN 1 146901140 missense probably benign
IGL02020:Brinp3 APN 1 146902127 utr 3 prime probably benign
IGL02082:Brinp3 APN 1 146751862 missense probably damaging 1.00
IGL02365:Brinp3 APN 1 146901122 missense probably benign 0.00
IGL02366:Brinp3 APN 1 146701743 missense possibly damaging 0.84
IGL02565:Brinp3 APN 1 146902032 missense probably damaging 0.98
IGL02999:Brinp3 APN 1 146701849 splice site probably null
IGL03099:Brinp3 APN 1 146902097 missense possibly damaging 0.91
PIT4283001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
PIT4418001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0266:Brinp3 UTSW 1 146682680 nonsense probably null
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1522:Brinp3 UTSW 1 146901890 missense probably damaging 0.99
R1596:Brinp3 UTSW 1 146514782 missense probably benign
R1898:Brinp3 UTSW 1 146901249 missense possibly damaging 0.93
R2036:Brinp3 UTSW 1 146701841 missense possibly damaging 0.84
R2224:Brinp3 UTSW 1 146901920 nonsense probably null
R2272:Brinp3 UTSW 1 146901404 missense possibly damaging 0.93
R2291:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R2322:Brinp3 UTSW 1 146701754 missense probably benign
R2880:Brinp3 UTSW 1 146902002 missense probably damaging 0.98
R3918:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3939:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3940:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3941:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3942:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R4095:Brinp3 UTSW 1 146901692 missense possibly damaging 0.72
R4783:Brinp3 UTSW 1 146727640 intron probably benign
R5009:Brinp3 UTSW 1 146901049 missense probably benign 0.25
R5034:Brinp3 UTSW 1 146727720 intron probably benign
R5166:Brinp3 UTSW 1 146901367 missense probably damaging 0.96
R5372:Brinp3 UTSW 1 146831726 missense probably damaging 1.00
R5472:Brinp3 UTSW 1 146901459 missense possibly damaging 0.86
R5651:Brinp3 UTSW 1 146701799 missense probably benign 0.01
R5681:Brinp3 UTSW 1 146901746 missense probably benign 0.12
R6351:Brinp3 UTSW 1 146901585 missense probably damaging 0.96
R6470:Brinp3 UTSW 1 146901906 missense probably damaging 0.99
R6499:Brinp3 UTSW 1 146901693 missense possibly damaging 0.86
R7078:Brinp3 UTSW 1 146514889 nonsense probably null
R7223:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R7322:Brinp3 UTSW 1 146682688 nonsense probably null
R7347:Brinp3 UTSW 1 146902086 missense probably benign 0.22
R7375:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7412:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7532:Brinp3 UTSW 1 146901401 missense probably damaging 0.98
R7562:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7576:Brinp3 UTSW 1 146901563 missense probably damaging 0.99
R7723:Brinp3 UTSW 1 146701671 missense probably damaging 1.00
R7737:Brinp3 UTSW 1 146682594 missense probably damaging 0.98
R7793:Brinp3 UTSW 1 146746568 missense probably benign 0.20
X0060:Brinp3 UTSW 1 146901786 missense probably benign 0.01
Z1176:Brinp3 UTSW 1 146902076 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTTTGAGACCGACCTACAAGAC -3'
(R):5'- GCCATTTGCCTTGATGCGACTC -3'

Sequencing Primer
(F):5'- GACCTAGAGATGAAATACCTGTTGC -3'
(R):5'- ATGCGACTCCTCAGGTAGATG -3'
Posted On2013-08-06