Incidental Mutation 'R8395:Kiz'
ID647554
Institutional Source Beutler Lab
Gene Symbol Kiz
Ensembl Gene ENSMUSG00000074749
Gene Namekizuna centrosomal protein
SynonymsPlk1s1, LOC228730, Ncrna00153, Gm114
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8395 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location146855864-146970097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146953029 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 603 (N603S)
Ref Sequence ENSEMBL: ENSMUSP00000096884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099278]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099278
AA Change: N603S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749
AA Change: N603S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
coiled coil region 102 132 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,726 V760A probably benign Het
Abcb9 T C 5: 124,080,217 E352G possibly damaging Het
Ascc3 T C 10: 50,649,304 F532L possibly damaging Het
Bckdk G A 7: 127,907,967 V328I probably benign Het
Cenpu T C 8: 46,554,049 Y26H probably benign Het
Clk3 A T 9: 57,765,162 V119E probably benign Het
Cnn2 A G 10: 79,992,459 N90S probably benign Het
Dlk2 T C 17: 46,301,043 I78T probably damaging Het
Ercc8 G T 13: 108,187,254 E367* probably null Het
Gbp9 A T 5: 105,080,203 I571K probably damaging Het
Gm3404 T C 5: 146,525,914 I29T possibly damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Heatr5a A G 12: 51,916,178 S74P Het
Htr6 T G 4: 139,061,767 M326L possibly damaging Het
Ighv5-8 C T 12: 113,655,193 A76V unknown Het
Ippk A G 13: 49,461,620 E493G probably damaging Het
Limch1 A T 5: 66,969,051 K7N probably damaging Het
Lrp1b C T 2: 40,657,399 C4257Y Het
Map4k5 C G 12: 69,830,429 R381T probably null Het
Map9 A G 3: 82,381,969 I455V probably benign Het
Mpped1 T C 15: 83,800,056 V93A probably damaging Het
Myh10 T C 11: 68,792,016 L1129P probably damaging Het
Neb T A 2: 52,175,633 M6196L probably benign Het
Neb C A 2: 52,257,794 V2738F probably damaging Het
Olfr1049 G A 2: 86,255,534 S53F possibly damaging Het
Olfr287 A G 15: 98,207,619 V255A probably benign Het
Sgf29 T A 7: 126,672,665 C287* probably null Het
Siglece A G 7: 43,656,099 V398A probably benign Het
Slc43a1 T C 2: 84,840,922 L67P probably damaging Het
Slco2a1 A G 9: 103,077,040 H470R probably benign Het
Syngr1 T C 15: 80,113,244 S188P probably benign Het
Trpm4 T C 7: 45,309,210 D885G probably benign Het
Ubd A T 17: 37,195,358 Q45L probably damaging Het
Unc45a A T 7: 80,326,332 C800S probably benign Het
Vmn2r112 A G 17: 22,618,606 T683A possibly damaging Het
Vmn2r25 T A 6: 123,823,023 T787S possibly damaging Het
Vmn2r85 G A 10: 130,425,928 P180L probably damaging Het
Vtcn1 T C 3: 100,883,754 F36S probably benign Het
Wdr86 A G 5: 24,730,189 L52P probably damaging Het
Xpo4 A T 14: 57,648,467 S43T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Other mutations in Kiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Kiz APN 2 146863801 missense probably benign 0.22
IGL01649:Kiz APN 2 146889309 missense probably benign 0.35
IGL02184:Kiz APN 2 146889600 missense probably benign 0.20
IGL02500:Kiz APN 2 146863813 missense probably benign 0.06
IGL02548:Kiz APN 2 146870770 missense probably damaging 0.99
R0284:Kiz UTSW 2 146863810 missense probably benign 0.22
R0364:Kiz UTSW 2 146942156 missense probably benign 0.20
R0478:Kiz UTSW 2 146942158 missense possibly damaging 0.93
R0685:Kiz UTSW 2 146856058 splice site probably benign
R0767:Kiz UTSW 2 146889051 missense probably damaging 1.00
R0866:Kiz UTSW 2 146856053 splice site probably benign
R1180:Kiz UTSW 2 146970007 missense unknown
R2037:Kiz UTSW 2 146969960 missense probably damaging 1.00
R2055:Kiz UTSW 2 146891283 missense probably benign 0.10
R2877:Kiz UTSW 2 146889556 missense possibly damaging 0.75
R4780:Kiz UTSW 2 146889246 missense possibly damaging 0.90
R4822:Kiz UTSW 2 146891069 missense probably damaging 1.00
R4835:Kiz UTSW 2 146942088 missense probably damaging 1.00
R5004:Kiz UTSW 2 146969979 missense possibly damaging 0.83
R5473:Kiz UTSW 2 146969995 nonsense probably null
R5878:Kiz UTSW 2 146889601 missense probably damaging 0.99
R6216:Kiz UTSW 2 146889497 missense probably damaging 1.00
R6222:Kiz UTSW 2 146891061 missense probably damaging 1.00
R7144:Kiz UTSW 2 146950510 splice site probably null
R7475:Kiz UTSW 2 146891086 missense possibly damaging 0.90
R7580:Kiz UTSW 2 146956249 missense probably damaging 0.99
R7848:Kiz UTSW 2 146889180 missense probably benign 0.19
R8513:Kiz UTSW 2 146870764 critical splice acceptor site probably null
RF021:Kiz UTSW 2 146870830 missense possibly damaging 0.74
Z1177:Kiz UTSW 2 146935827 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- AGATAAGTTGGATTCCACAGGG -3'
(R):5'- CCTCCAAATGCTTGTCTGTTAAG -3'

Sequencing Primer
(F):5'- GGGAAACCGTGCATTTCAG -3'
(R):5'- GGATGAAAAGTTCTTGCTCACTC -3'
Posted On2020-09-02