Incidental Mutation 'R8395:Vtcn1'
ID647557
Institutional Source Beutler Lab
Gene Symbol Vtcn1
Ensembl Gene ENSMUSG00000051076
Gene NameV-set domain containing T cell activation inhibitor 1
SynonymsB7x, B7-H4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R8395 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location100825459-100896922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100883754 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 36 (F36S)
Ref Sequence ENSEMBL: ENSMUSP00000057721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054791]
Predicted Effect probably benign
Transcript: ENSMUST00000054791
AA Change: F36S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057721
Gene: ENSMUSG00000051076
AA Change: F36S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
IG 41 146 3.13e-5 SMART
Blast:IG_like 153 243 5e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the B7 costimulatory protein family. Proteins in this family are present on the surface of antigen-presenting cells and interact with ligand bound to receptors on the surface of T cells. Studies have shown that high levels of the encoded protein has been correlated with tumor progression. A pseudogene of this gene is located on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for this mutation display stronger Th1 responses upon parasitic infection by L. major including reduced footpad swelling and lower parasite burden compared to controls. Responses to other Th1-driven immune responses are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,726 V760A probably benign Het
Abcb9 T C 5: 124,080,217 E352G possibly damaging Het
Ascc3 T C 10: 50,649,304 F532L possibly damaging Het
Bckdk G A 7: 127,907,967 V328I probably benign Het
Cenpu T C 8: 46,554,049 Y26H probably benign Het
Clk3 A T 9: 57,765,162 V119E probably benign Het
Cnn2 A G 10: 79,992,459 N90S probably benign Het
Dlk2 T C 17: 46,301,043 I78T probably damaging Het
Ercc8 G T 13: 108,187,254 E367* probably null Het
Gbp9 A T 5: 105,080,203 I571K probably damaging Het
Gm3404 T C 5: 146,525,914 I29T possibly damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Heatr5a A G 12: 51,916,178 S74P Het
Htr6 T G 4: 139,061,767 M326L possibly damaging Het
Ighv5-8 C T 12: 113,655,193 A76V unknown Het
Ippk A G 13: 49,461,620 E493G probably damaging Het
Kiz A G 2: 146,953,029 N603S possibly damaging Het
Limch1 A T 5: 66,969,051 K7N probably damaging Het
Lrp1b C T 2: 40,657,399 C4257Y Het
Map4k5 C G 12: 69,830,429 R381T probably null Het
Map9 A G 3: 82,381,969 I455V probably benign Het
Mpped1 T C 15: 83,800,056 V93A probably damaging Het
Myh10 T C 11: 68,792,016 L1129P probably damaging Het
Neb T A 2: 52,175,633 M6196L probably benign Het
Neb C A 2: 52,257,794 V2738F probably damaging Het
Olfr1049 G A 2: 86,255,534 S53F possibly damaging Het
Olfr287 A G 15: 98,207,619 V255A probably benign Het
Sgf29 T A 7: 126,672,665 C287* probably null Het
Siglece A G 7: 43,656,099 V398A probably benign Het
Slc43a1 T C 2: 84,840,922 L67P probably damaging Het
Slco2a1 A G 9: 103,077,040 H470R probably benign Het
Syngr1 T C 15: 80,113,244 S188P probably benign Het
Trpm4 T C 7: 45,309,210 D885G probably benign Het
Ubd A T 17: 37,195,358 Q45L probably damaging Het
Unc45a A T 7: 80,326,332 C800S probably benign Het
Vmn2r112 A G 17: 22,618,606 T683A possibly damaging Het
Vmn2r25 T A 6: 123,823,023 T787S possibly damaging Het
Vmn2r85 G A 10: 130,425,928 P180L probably damaging Het
Wdr86 A G 5: 24,730,189 L52P probably damaging Het
Xpo4 A T 14: 57,648,467 S43T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Other mutations in Vtcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Vtcn1 APN 3 100888347 missense probably damaging 1.00
IGL02376:Vtcn1 APN 3 100892665 missense probably benign 0.05
IGL02833:Vtcn1 APN 3 100888385 missense probably damaging 1.00
IGL02876:Vtcn1 APN 3 100883829 missense probably damaging 0.97
IGL03018:Vtcn1 APN 3 100883910 missense probably damaging 0.98
R2431:Vtcn1 UTSW 3 100825577 missense possibly damaging 0.53
R4194:Vtcn1 UTSW 3 100888209 missense probably damaging 0.97
R4881:Vtcn1 UTSW 3 100892593 missense probably benign
R6916:Vtcn1 UTSW 3 100888163 critical splice acceptor site probably null
R7147:Vtcn1 UTSW 3 100883894 missense probably damaging 0.99
R7739:Vtcn1 UTSW 3 100883895 missense probably damaging 1.00
R8365:Vtcn1 UTSW 3 100883829 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGGTACCAACATTTCTTCCTGC -3'
(R):5'- GCATTGCCAACTACCACCTG -3'

Sequencing Primer
(F):5'- GCTCTTTCTAGTCTTTCCAGTCATG -3'
(R):5'- AACATCTCATGCTGCTGTGAGAG -3'
Posted On2020-09-02