Incidental Mutation 'R8395:Heatr5a'
ID647578
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene NameHEAT repeat containing 5A
SynonymsD930036F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R8395 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location51875871-51971321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51916178 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 74 (S74P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040583
AA Change: S980P

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: S980P

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,726 V760A probably benign Het
Abcb9 T C 5: 124,080,217 E352G possibly damaging Het
Ascc3 T C 10: 50,649,304 F532L possibly damaging Het
Bckdk G A 7: 127,907,967 V328I probably benign Het
Cenpu T C 8: 46,554,049 Y26H probably benign Het
Clk3 A T 9: 57,765,162 V119E probably benign Het
Cnn2 A G 10: 79,992,459 N90S probably benign Het
Dlk2 T C 17: 46,301,043 I78T probably damaging Het
Ercc8 G T 13: 108,187,254 E367* probably null Het
Gbp9 A T 5: 105,080,203 I571K probably damaging Het
Gm3404 T C 5: 146,525,914 I29T possibly damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Htr6 T G 4: 139,061,767 M326L possibly damaging Het
Ighv5-8 C T 12: 113,655,193 A76V unknown Het
Ippk A G 13: 49,461,620 E493G probably damaging Het
Kiz A G 2: 146,953,029 N603S possibly damaging Het
Limch1 A T 5: 66,969,051 K7N probably damaging Het
Lrp1b C T 2: 40,657,399 C4257Y Het
Map4k5 C G 12: 69,830,429 R381T probably null Het
Map9 A G 3: 82,381,969 I455V probably benign Het
Mpped1 T C 15: 83,800,056 V93A probably damaging Het
Myh10 T C 11: 68,792,016 L1129P probably damaging Het
Neb T A 2: 52,175,633 M6196L probably benign Het
Neb C A 2: 52,257,794 V2738F probably damaging Het
Olfr1049 G A 2: 86,255,534 S53F possibly damaging Het
Olfr287 A G 15: 98,207,619 V255A probably benign Het
Sgf29 T A 7: 126,672,665 C287* probably null Het
Siglece A G 7: 43,656,099 V398A probably benign Het
Slc43a1 T C 2: 84,840,922 L67P probably damaging Het
Slco2a1 A G 9: 103,077,040 H470R probably benign Het
Syngr1 T C 15: 80,113,244 S188P probably benign Het
Trpm4 T C 7: 45,309,210 D885G probably benign Het
Ubd A T 17: 37,195,358 Q45L probably damaging Het
Unc45a A T 7: 80,326,332 C800S probably benign Het
Vmn2r112 A G 17: 22,618,606 T683A possibly damaging Het
Vmn2r25 T A 6: 123,823,023 T787S possibly damaging Het
Vmn2r85 G A 10: 130,425,928 P180L probably damaging Het
Vtcn1 T C 3: 100,883,754 F36S probably benign Het
Wdr86 A G 5: 24,730,189 L52P probably damaging Het
Xpo4 A T 14: 57,648,467 S43T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 splice site probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
R8088:Heatr5a UTSW 12 51947996 missense possibly damaging 0.85
R8205:Heatr5a UTSW 12 51959009 missense probably benign 0.05
R8212:Heatr5a UTSW 12 51899229 missense probably benign 0.00
R8213:Heatr5a UTSW 12 51891443 missense probably damaging 0.96
R8323:Heatr5a UTSW 12 51955506 missense probably benign 0.02
R8326:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8339:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8410:Heatr5a UTSW 12 51938120 missense probably benign 0.01
R8676:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8834:Heatr5a UTSW 12 51909956 critical splice donor site probably null
R8916:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ATATGCTAAGCAGAGAGACTAAGCC -3'
(R):5'- AGATTGGTAGCGGCACATC -3'

Sequencing Primer
(F):5'- AGCCTTAAGTTATTTCTATGCGTG -3'
(R):5'- GATTGGTAGCGGCACATCCATTC -3'
Posted On2020-09-02