Incidental Mutation 'R8395:1700014D04Rik'
ID 647582
Institutional Source Beutler Lab
Gene Symbol 1700014D04Rik
Ensembl Gene ENSMUSG00000051054
Gene Name RIKEN cDNA 1700014D04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R8395 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 59740842-59746752 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59741726 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 760 (V760A)
Ref Sequence ENSEMBL: ENSMUSP00000136424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055343] [ENSMUST00000178508] [ENSMUST00000180139]
AlphaFold J3QMS2
Predicted Effect probably benign
Transcript: ENSMUST00000055343
SMART Domains Protein: ENSMUSP00000052403
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178508
SMART Domains Protein: ENSMUSP00000136897
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
Pfam:FAM75 66 99 7.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180139
AA Change: V760A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136424
Gene: ENSMUSG00000051054
AA Change: V760A

DomainStartEndE-ValueType
Pfam:FAM75 66 439 6.9e-97 PFAM
low complexity region 622 633 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
low complexity region 737 763 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,080,217 E352G possibly damaging Het
Ascc3 T C 10: 50,649,304 F532L possibly damaging Het
Bckdk G A 7: 127,907,967 V328I probably benign Het
Cenpu T C 8: 46,554,049 Y26H probably benign Het
Clk3 A T 9: 57,765,162 V119E probably benign Het
Cnn2 A G 10: 79,992,459 N90S probably benign Het
Dlk2 T C 17: 46,301,043 I78T probably damaging Het
Ercc8 G T 13: 108,187,254 E367* probably null Het
Gbp9 A T 5: 105,080,203 I571K probably damaging Het
Gm3404 T C 5: 146,525,914 I29T possibly damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Heatr5a A G 12: 51,916,178 S74P Het
Htr6 T G 4: 139,061,767 M326L possibly damaging Het
Ighv5-8 C T 12: 113,655,193 A76V unknown Het
Ippk A G 13: 49,461,620 E493G probably damaging Het
Kiz A G 2: 146,953,029 N603S possibly damaging Het
Limch1 A T 5: 66,969,051 K7N probably damaging Het
Lrp1b C T 2: 40,657,399 C4257Y Het
Map4k5 C G 12: 69,830,429 R381T probably null Het
Map9 A G 3: 82,381,969 I455V probably benign Het
Mpped1 T C 15: 83,800,056 V93A probably damaging Het
Myh10 T C 11: 68,792,016 L1129P probably damaging Het
Neb T A 2: 52,175,633 M6196L probably benign Het
Neb C A 2: 52,257,794 V2738F probably damaging Het
Olfr1049 G A 2: 86,255,534 S53F possibly damaging Het
Olfr287 A G 15: 98,207,619 V255A probably benign Het
Sgf29 T A 7: 126,672,665 C287* probably null Het
Siglece A G 7: 43,656,099 V398A probably benign Het
Slc43a1 T C 2: 84,840,922 L67P probably damaging Het
Slco2a1 A G 9: 103,077,040 H470R probably benign Het
Syngr1 T C 15: 80,113,244 S188P probably benign Het
Trpm4 T C 7: 45,309,210 D885G probably benign Het
Ubd A T 17: 37,195,358 Q45L probably damaging Het
Unc45a A T 7: 80,326,332 C800S probably benign Het
Vmn2r112 A G 17: 22,618,606 T683A possibly damaging Het
Vmn2r25 T A 6: 123,823,023 T787S possibly damaging Het
Vmn2r85 G A 10: 130,425,928 P180L probably damaging Het
Vtcn1 T C 3: 100,883,754 F36S probably benign Het
Wdr86 A G 5: 24,730,189 L52P probably damaging Het
Xpo4 A T 14: 57,648,467 S43T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Other mutations in 1700014D04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB010:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
BB020:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R0838:1700014D04Rik UTSW 13 59742468 missense possibly damaging 0.75
R1483:1700014D04Rik UTSW 13 59742903 missense probably damaging 0.99
R1794:1700014D04Rik UTSW 13 59742620 missense probably benign 0.22
R1842:1700014D04Rik UTSW 13 59742506 missense probably damaging 1.00
R1969:1700014D04Rik UTSW 13 59742785 missense probably damaging 0.98
R2027:1700014D04Rik UTSW 13 59742587 missense possibly damaging 0.48
R2206:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2207:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2882:1700014D04Rik UTSW 13 59742943 missense probably benign 0.00
R3508:1700014D04Rik UTSW 13 59742505 nonsense probably null
R4447:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R4560:1700014D04Rik UTSW 13 59741757 missense probably damaging 1.00
R4846:1700014D04Rik UTSW 13 59742233 missense probably benign 0.00
R5186:1700014D04Rik UTSW 13 59743739 missense probably damaging 1.00
R5510:1700014D04Rik UTSW 13 59742420 splice site probably null
R5580:1700014D04Rik UTSW 13 59742256 missense probably benign 0.00
R5752:1700014D04Rik UTSW 13 59743202 missense probably damaging 0.96
R6266:1700014D04Rik UTSW 13 59742312 missense probably benign 0.33
R6267:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6296:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6939:1700014D04Rik UTSW 13 59742058 missense possibly damaging 0.75
R6973:1700014D04Rik UTSW 13 59742707 missense probably benign 0.14
R7107:1700014D04Rik UTSW 13 59742183 nonsense probably null
R7123:1700014D04Rik UTSW 13 59743440 nonsense probably null
R7254:1700014D04Rik UTSW 13 59741976 missense probably benign 0.01
R7354:1700014D04Rik UTSW 13 59741834 nonsense probably null
R7536:1700014D04Rik UTSW 13 59741742 missense probably damaging 0.99
R7729:1700014D04Rik UTSW 13 59741623 missense not run
R7912:1700014D04Rik UTSW 13 59742515 missense probably damaging 1.00
R7933:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R8029:1700014D04Rik UTSW 13 59742377 missense possibly damaging 0.79
R8347:1700014D04Rik UTSW 13 59742236 missense possibly damaging 0.63
R8370:1700014D04Rik UTSW 13 59743952 missense probably benign
R8508:1700014D04Rik UTSW 13 59743598 missense probably benign 0.02
R8930:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R8932:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R9127:1700014D04Rik UTSW 13 59743014 missense probably benign 0.00
R9262:1700014D04Rik UTSW 13 59742588 missense probably benign 0.00
R9401:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R9514:1700014D04Rik UTSW 13 59742992 missense probably damaging 0.96
X0024:1700014D04Rik UTSW 13 59742725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGTTCCCTCTTGCTTG -3'
(R):5'- CCATCAAAGATGTCAGTCCCTG -3'

Sequencing Primer
(F):5'- TGATTTCTCCTTACTAGGTTGGC -3'
(R):5'- AGATGTCAGTCCCTGAAGAGCC -3'
Posted On 2020-09-02