Incidental Mutation 'R8395:Ubd'
ID 647589
Institutional Source Beutler Lab
Gene Symbol Ubd
Ensembl Gene ENSMUSG00000035186
Gene Name ubiquitin D
Synonyms FAT10, Diubiquitin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8395 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37193892-37196095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37195358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 45 (Q45L)
Ref Sequence ENSEMBL: ENSMUSP00000035808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038844] [ENSMUST00000055324] [ENSMUST00000222190]
AlphaFold P63072
Predicted Effect probably damaging
Transcript: ENSMUST00000038844
AA Change: Q45L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035808
Gene: ENSMUSG00000035186
AA Change: Q45L

DomainStartEndE-ValueType
UBQ 5 76 8.61e-9 SMART
UBQ 88 158 9.23e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055324
SMART Domains Protein: ENSMUSP00000055232
Gene: ENSMUSG00000043827

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:7tm_4 105 382 6.5e-39 PFAM
Pfam:7TM_GPCR_Srsx 109 220 2.1e-9 PFAM
Pfam:7tm_1 115 365 3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222190
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hompzygous for disruptions in this gene show an increased susceptibility to low doses of endotoxin and increased apoptosis among lymphocytes but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,741,726 V760A probably benign Het
Abcb9 T C 5: 124,080,217 E352G possibly damaging Het
Ascc3 T C 10: 50,649,304 F532L possibly damaging Het
Bckdk G A 7: 127,907,967 V328I probably benign Het
Cenpu T C 8: 46,554,049 Y26H probably benign Het
Clk3 A T 9: 57,765,162 V119E probably benign Het
Cnn2 A G 10: 79,992,459 N90S probably benign Het
Dlk2 T C 17: 46,301,043 I78T probably damaging Het
Ercc8 G T 13: 108,187,254 E367* probably null Het
Gbp9 A T 5: 105,080,203 I571K probably damaging Het
Gm3404 T C 5: 146,525,914 I29T possibly damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Heatr5a A G 12: 51,916,178 S74P Het
Htr6 T G 4: 139,061,767 M326L possibly damaging Het
Ighv5-8 C T 12: 113,655,193 A76V unknown Het
Ippk A G 13: 49,461,620 E493G probably damaging Het
Kiz A G 2: 146,953,029 N603S possibly damaging Het
Limch1 A T 5: 66,969,051 K7N probably damaging Het
Lrp1b C T 2: 40,657,399 C4257Y Het
Map4k5 C G 12: 69,830,429 R381T probably null Het
Map9 A G 3: 82,381,969 I455V probably benign Het
Mpped1 T C 15: 83,800,056 V93A probably damaging Het
Myh10 T C 11: 68,792,016 L1129P probably damaging Het
Neb T A 2: 52,175,633 M6196L probably benign Het
Neb C A 2: 52,257,794 V2738F probably damaging Het
Olfr1049 G A 2: 86,255,534 S53F possibly damaging Het
Olfr287 A G 15: 98,207,619 V255A probably benign Het
Sgf29 T A 7: 126,672,665 C287* probably null Het
Siglece A G 7: 43,656,099 V398A probably benign Het
Slc43a1 T C 2: 84,840,922 L67P probably damaging Het
Slco2a1 A G 9: 103,077,040 H470R probably benign Het
Syngr1 T C 15: 80,113,244 S188P probably benign Het
Trpm4 T C 7: 45,309,210 D885G probably benign Het
Unc45a A T 7: 80,326,332 C800S probably benign Het
Vmn2r112 A G 17: 22,618,606 T683A possibly damaging Het
Vmn2r25 T A 6: 123,823,023 T787S possibly damaging Het
Vmn2r85 G A 10: 130,425,928 P180L probably damaging Het
Vtcn1 T C 3: 100,883,754 F36S probably benign Het
Wdr86 A G 5: 24,730,189 L52P probably damaging Het
Xpo4 A T 14: 57,648,467 S43T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Other mutations in Ubd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02626:Ubd APN 17 37195682 missense probably damaging 1.00
IGL02668:Ubd APN 17 37195529 missense probably benign 0.07
IGL02725:Ubd APN 17 37193962 missense probably benign 0.14
PIT4696001:Ubd UTSW 17 37195444 missense probably damaging 1.00
R1163:Ubd UTSW 17 37195321 missense probably damaging 0.99
R4731:Ubd UTSW 17 37195702 missense probably benign 0.05
R4732:Ubd UTSW 17 37195702 missense probably benign 0.05
R4733:Ubd UTSW 17 37195702 missense probably benign 0.05
R5648:Ubd UTSW 17 37195454 missense probably damaging 1.00
R6332:Ubd UTSW 17 37195501 missense probably benign 0.01
R6346:Ubd UTSW 17 37195351 nonsense probably null
R7687:Ubd UTSW 17 37193974 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGACTGTTGAGAAGGAGCC -3'
(R):5'- TGAGCTGGATCTTCGAACTC -3'

Sequencing Primer
(F):5'- CCAACCAGGAGAACAGTGAAGC -3'
(R):5'- ATCTTCGAACTCGGAGGAGGTG -3'
Posted On 2020-09-02