Incidental Mutation 'R8396:Cr2'
ID 647592
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 067812-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R8396 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 194840376 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 522 (L522P)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082321
AA Change: L522P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: L522P

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193356
AA Change: L225P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: L225P

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: L522P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: L522P

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210219
AA Change: L898P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef3 A G 10: 18,528,280 (GRCm39) probably null Het
Arid1a T C 4: 133,479,973 (GRCm39) Y317C probably damaging Het
Asxl2 A G 12: 3,552,220 (GRCm39) T1321A probably benign Het
Bckdk A G 7: 127,504,931 (GRCm39) Y129C probably damaging Het
Birc2 A G 9: 7,834,301 (GRCm39) V60A probably benign Het
Bmp8a T C 4: 123,218,952 (GRCm39) H152R probably benign Het
C3 T C 17: 57,528,029 (GRCm39) H730R probably benign Het
Ccser1 T A 6: 61,289,088 (GRCm39) V417E probably benign Het
Cfap58 T A 19: 48,017,540 (GRCm39) M800K probably damaging Het
Clip1 A G 5: 123,780,627 (GRCm39) L352P probably damaging Het
Ctcf T A 8: 106,393,379 (GRCm39) H347Q possibly damaging Het
Gm13271 A T 4: 88,673,318 (GRCm39) M72L probably benign Het
Gpat4 GTGTT GT 8: 23,669,498 (GRCm39) probably benign Het
Ighv5-8 C T 12: 113,618,813 (GRCm39) A76V unknown Het
Irx5 G A 8: 93,086,962 (GRCm39) G298D probably benign Het
Klf5 T C 14: 99,539,670 (GRCm39) I361T possibly damaging Het
Lsm11 G A 11: 45,835,591 (GRCm39) A50V probably benign Het
Map1b T C 13: 99,570,621 (GRCm39) K700R unknown Het
Muc5b A T 7: 141,405,552 (GRCm39) T954S unknown Het
Nhsl1 A G 10: 18,400,910 (GRCm39) N678S probably benign Het
Npsr1 T A 9: 24,221,377 (GRCm39) I277N possibly damaging Het
Ntsr2 A G 12: 16,706,821 (GRCm39) H283R probably damaging Het
Obscn A T 11: 58,893,829 (GRCm39) I6746N probably benign Het
Obsl1 T C 1: 75,480,350 (GRCm39) T425A probably benign Het
Pag1 T A 3: 9,759,112 (GRCm39) E335D probably benign Het
Parp3 T A 9: 106,351,447 (GRCm39) Q223L probably benign Het
Pogz T C 3: 94,786,061 (GRCm39) V883A probably benign Het
Rsbn1l A T 5: 21,132,665 (GRCm39) M198K probably benign Het
Sh3bgr A G 16: 96,007,680 (GRCm39) probably null Het
Shc4 A G 2: 125,471,617 (GRCm39) I600T probably damaging Het
Slc26a1 T C 5: 108,821,715 (GRCm39) H74R probably benign Het
Slc7a11 A C 3: 50,338,578 (GRCm39) I277S possibly damaging Het
Tep1 G T 14: 51,074,529 (GRCm39) T1832N probably benign Het
Terf2 A G 8: 107,809,613 (GRCm39) probably null Het
Tle4 G A 19: 14,432,323 (GRCm39) Q458* probably null Het
Trim34b A T 7: 103,979,083 (GRCm39) D110V probably damaging Het
Usp9y A T Y: 1,308,034 (GRCm39) N2267K possibly damaging Het
Vmn2r50 G A 7: 9,781,639 (GRCm39) Q369* probably null Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp229 T C 17: 21,965,077 (GRCm39) S436P probably damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTTTGACGCAACCCAAAGTAGG -3'
(R):5'- CTATGCAGTTAATGGATGGTGC -3'

Sequencing Primer
(F):5'- CCCAAAGTAGGAATTTTGGCTCC -3'
(R):5'- CAGTTAATGGATGGTGCTGAGG -3'
Posted On 2020-09-02