Incidental Mutation 'R0021:C5ar2'
ID64760
Institutional Source Beutler Lab
Gene Symbol C5ar2
Ensembl Gene ENSMUSG00000074361
Gene Namecomplement component 5a receptor 2
SynonymsGpr77, C5L2, E030029A11Rik
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0021 (G1)
Quality Score97
Status Validated
Chromosome7
Chromosomal Location16234585-16244154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16237676 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 109 (F109L)
Ref Sequence ENSEMBL: ENSMUSP00000133056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098792] [ENSMUST00000171425]
Predicted Effect probably benign
Transcript: ENSMUST00000098792
AA Change: F109L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096389
Gene: ENSMUSG00000074361
AA Change: F109L

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 68 N/A INTRINSIC
Pfam:7tm_1 72 311 9.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116763
Predicted Effect probably benign
Transcript: ENSMUST00000171425
AA Change: F109L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133056
Gene: ENSMUSG00000074361
AA Change: F109L

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 68 N/A INTRINSIC
Pfam:7tm_1 72 257 7e-21 PFAM
Pfam:7tm_1 243 311 8.2e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor 1 family member involved in the complement system of the innate immune response. Unlike classical G-protein coupled receptors, the encoded protein does not associate with intracellular G-proteins. It may instead modulate signal transduction through the beta-arrestin pathway, and may alternatively act as a decoy receptor. This gene may be involved in coronary artery disease and in the pathogenesis of sepsis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice display increased inflammatory response and chemotaxis after exposure to anaphylatoxins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in C5ar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0848:C5ar2 UTSW 7 16237601 missense probably benign 0.35
R3078:C5ar2 UTSW 7 16237424 missense probably damaging 1.00
R4775:C5ar2 UTSW 7 16237615 missense probably damaging 0.98
R5549:C5ar2 UTSW 7 16236943 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCCAAATGTTCGATGATCTGCACC -3'
(R):5'- CCATGAACACTACAGTGACCTTCCG -3'

Sequencing Primer
(F):5'- GATGATCTGCACCCTTCCAG -3'
(R):5'- AGCTGGCACCTGCTTCAC -3'
Posted On2013-08-06