Incidental Mutation 'R0021:V1rd19'
ID64761
Institutional Source Beutler Lab
Gene Symbol V1rd19
Ensembl Gene ENSMUSG00000092456
Gene Namevomeronasal 1 receptor, D19
Synonyms
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0021 (G1)
Quality Score86
Status Validated
Chromosome7
Chromosomal Location24003091-24004247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24003604 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 165 (D165V)
Ref Sequence ENSEMBL: ENSMUSP00000133284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173571]
Predicted Effect probably damaging
Transcript: ENSMUST00000173571
AA Change: D165V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133284
Gene: ENSMUSG00000092456
AA Change: D165V

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 1e-9 PFAM
Pfam:V1R 42 295 5.9e-13 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
Other mutations in V1rd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:V1rd19 APN 7 24003400 missense probably damaging 1.00
IGL02898:V1rd19 APN 7 24003429 missense probably damaging 1.00
IGL03231:V1rd19 APN 7 24003903 missense probably benign 0.00
R0184:V1rd19 UTSW 7 24003207 missense probably benign 0.06
R0391:V1rd19 UTSW 7 24003585 missense probably damaging 0.98
R1520:V1rd19 UTSW 7 24003198 missense probably damaging 0.99
R1635:V1rd19 UTSW 7 24003387 missense probably benign 0.30
R1861:V1rd19 UTSW 7 24003724 missense probably damaging 1.00
R1889:V1rd19 UTSW 7 24003207 missense probably benign 0.06
R2008:V1rd19 UTSW 7 24003301 nonsense probably null
R2059:V1rd19 UTSW 7 24003834 missense probably benign 0.01
R2098:V1rd19 UTSW 7 24003735 missense probably damaging 1.00
R3001:V1rd19 UTSW 7 24003885 missense probably benign 0.00
R3002:V1rd19 UTSW 7 24003885 missense probably benign 0.00
R4271:V1rd19 UTSW 7 24003414 missense probably benign 0.36
R5130:V1rd19 UTSW 7 24003112 start codon destroyed probably null 1.00
R5169:V1rd19 UTSW 7 24003784 missense possibly damaging 0.75
R5297:V1rd19 UTSW 7 24003289 missense probably damaging 0.99
R5924:V1rd19 UTSW 7 24003949 missense probably benign
R6181:V1rd19 UTSW 7 24003215 missense possibly damaging 0.46
R6540:V1rd19 UTSW 7 24003631 nonsense probably null
R7331:V1rd19 UTSW 7 24003883 missense probably damaging 0.97
R7332:V1rd19 UTSW 7 24003318 missense probably benign 0.09
X0065:V1rd19 UTSW 7 24003336 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGTTCTAAACAGAGGCCCAGACAAG -3'
(R):5'- CCAGCATCAGGATAGTATGGGTTGC -3'

Sequencing Primer
(F):5'- GCCCAGACAAGTGATTTTAAGAC -3'
(R):5'- CCTGATTGAGAGTGAATATGTACTGC -3'
Posted On2013-08-06