Incidental Mutation 'R8396:Irx5'
ID647610
Institutional Source Beutler Lab
Gene Symbol Irx5
Ensembl Gene ENSMUSG00000031737
Gene NameIroquois homeobox 5
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8396 (G1)
Quality Score150.008
Status Not validated
Chromosome8
Chromosomal Location92357625-92376286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92360334 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 298 (G298D)
Ref Sequence ENSEMBL: ENSMUSP00000034184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034184] [ENSMUST00000210246]
Predicted Effect probably benign
Transcript: ENSMUST00000034184
AA Change: G298D

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034184
Gene: ENSMUSG00000031737
AA Change: G298D

DomainStartEndE-ValueType
HOX 112 177 1.14e-12 SMART
low complexity region 185 202 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
IRO 328 345 2.28e-5 SMART
low complexity region 351 369 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 417 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210246
AA Change: G298D

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, narrow eye opening, and impaired retinal cone bipolar cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef3 A G 10: 18,652,532 probably null Het
Arid1a T C 4: 133,752,662 Y317C probably damaging Het
Asxl2 A G 12: 3,502,220 T1321A probably benign Het
Bckdk A G 7: 127,905,759 Y129C probably damaging Het
Birc2 A G 9: 7,834,300 V60A probably benign Het
Bmp8a T C 4: 123,325,159 H152R probably benign Het
C3 T C 17: 57,221,029 H730R probably benign Het
Ccser1 T A 6: 61,312,104 V417E probably benign Het
Cfap58 T A 19: 48,029,101 M800K probably damaging Het
Clip1 A G 5: 123,642,564 L352P probably damaging Het
Cr2 A G 1: 195,158,068 L522P probably damaging Het
Ctcf T A 8: 105,666,747 H347Q possibly damaging Het
Gm13271 A T 4: 88,755,081 M72L probably benign Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Ighv5-8 C T 12: 113,655,193 A76V unknown Het
Klf5 T C 14: 99,302,234 I361T possibly damaging Het
Lsm11 G A 11: 45,944,764 A50V probably benign Het
Map1b T C 13: 99,434,113 K700R unknown Het
Muc5b A T 7: 141,851,815 T954S unknown Het
Nhsl1 A G 10: 18,525,162 N678S probably benign Het
Npsr1 T A 9: 24,310,081 I277N possibly damaging Het
Ntsr2 A G 12: 16,656,820 H283R probably damaging Het
Obscn A T 11: 59,003,003 I6746N probably benign Het
Obsl1 T C 1: 75,503,706 T425A probably benign Het
Pag1 T A 3: 9,694,052 E335D probably benign Het
Parp3 T A 9: 106,474,248 Q223L probably benign Het
Pogz T C 3: 94,878,750 V883A probably benign Het
Rsbn1l A T 5: 20,927,667 M198K probably benign Het
Sh3bgr A G 16: 96,206,480 probably null Het
Shc4 A G 2: 125,629,697 I600T probably damaging Het
Slc26a1 T C 5: 108,673,849 H74R probably benign Het
Slc7a11 A C 3: 50,384,129 I277S possibly damaging Het
Tep1 G T 14: 50,837,072 T1832N probably benign Het
Terf2 A G 8: 107,082,981 probably null Het
Tle4 G A 19: 14,454,959 Q458* probably null Het
Trim34b A T 7: 104,329,876 D110V probably damaging Het
Usp9y A T Y: 1,308,034 N2267K possibly damaging Het
Vmn2r50 G A 7: 10,047,712 Q369* probably null Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp229 T C 17: 21,746,096 S436P probably damaging Het
Other mutations in Irx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Irx5 APN 8 92360703 missense probably damaging 1.00
IGL01870:Irx5 APN 8 92359777 missense probably damaging 1.00
IGL01985:Irx5 APN 8 92359527 splice site probably benign
IGL02481:Irx5 APN 8 92360679 missense probably damaging 1.00
IGL02597:Irx5 APN 8 92360772 missense possibly damaging 0.93
IGL03257:Irx5 APN 8 92360630 missense probably benign 0.00
R0784:Irx5 UTSW 8 92360490 missense probably benign
R1498:Irx5 UTSW 8 92359886 missense probably damaging 1.00
R1762:Irx5 UTSW 8 92359644 missense probably damaging 1.00
R1783:Irx5 UTSW 8 92359688 missense probably damaging 1.00
R1951:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R1953:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R2019:Irx5 UTSW 8 92358364 missense probably damaging 1.00
R3875:Irx5 UTSW 8 92360165 missense probably benign 0.00
R3942:Irx5 UTSW 8 92359686 missense probably damaging 0.98
R4361:Irx5 UTSW 8 92358397 missense probably damaging 0.99
R4574:Irx5 UTSW 8 92358262 missense probably damaging 0.99
R4994:Irx5 UTSW 8 92360781 missense probably damaging 1.00
R5579:Irx5 UTSW 8 92359913 missense probably benign 0.01
R5884:Irx5 UTSW 8 92360630 missense possibly damaging 0.95
R5988:Irx5 UTSW 8 92360671 nonsense probably null
R6017:Irx5 UTSW 8 92358250 missense probably damaging 1.00
R6339:Irx5 UTSW 8 92359853 missense probably damaging 0.99
R6466:Irx5 UTSW 8 92359726 missense probably damaging 1.00
R6595:Irx5 UTSW 8 92359619 missense probably damaging 1.00
R7344:Irx5 UTSW 8 92359555 missense probably benign 0.24
R8166:Irx5 UTSW 8 92360084 splice site probably null
R8215:Irx5 UTSW 8 92359613 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CCGAATCAGGTTGGTGGATG -3'
(R):5'- CGCCGTGTAATAAAGAGGCC -3'

Sequencing Primer
(F):5'- CTCTGACAGCCTGGGTTTCG -3'
(R):5'- GCTGCCTCCAAGCGTTTG -3'
Posted On2020-09-02