Incidental Mutation 'R0021:Aplp1'
ID64762
Institutional Source Beutler Lab
Gene Symbol Aplp1
Ensembl Gene ENSMUSG00000006651
Gene Nameamyloid beta (A4) precursor-like protein 1
Synonyms
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0021 (G1)
Quality Score209
Status Validated
Chromosome7
Chromosomal Location30434982-30445535 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 30435816 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006828]
Predicted Effect probably benign
Transcript: ENSMUST00000006828
SMART Domains Protein: ENSMUSP00000006828
Gene: ENSMUSG00000006651

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
A4_EXTRA 46 211 1.72e-114 SMART
low complexity region 234 247 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
Pfam:APP_E2 289 471 9.3e-72 PFAM
Pfam:APP_amyloid 600 651 9.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208792
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved amyloid precursor protein gene family. The encoded protein is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. This cleavage liberates an intracellular cytoplasmic fragment that may act as a transcriptional activator. The encoded protein may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show a 10% decrease in body weight at 9 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Aplp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Aplp1 APN 7 30444418 missense probably damaging 0.97
R0021:Aplp1 UTSW 7 30435816 splice site probably benign
R0034:Aplp1 UTSW 7 30444442 missense probably damaging 1.00
R1480:Aplp1 UTSW 7 30436023 missense probably benign 0.01
R1538:Aplp1 UTSW 7 30436027 missense probably benign
R2177:Aplp1 UTSW 7 30442521 nonsense probably null
R3017:Aplp1 UTSW 7 30435971 critical splice donor site probably null
R5143:Aplp1 UTSW 7 30441123 missense probably damaging 1.00
R5465:Aplp1 UTSW 7 30436852 missense probably benign
R5482:Aplp1 UTSW 7 30440175 missense probably damaging 1.00
R5530:Aplp1 UTSW 7 30436829 missense possibly damaging 0.70
R6112:Aplp1 UTSW 7 30435477 missense probably damaging 1.00
R6721:Aplp1 UTSW 7 30440295 missense probably null 1.00
R6931:Aplp1 UTSW 7 30443200 missense probably damaging 1.00
R7314:Aplp1 UTSW 7 30435989 missense probably damaging 0.98
R7707:Aplp1 UTSW 7 30443098 missense probably damaging 1.00
R8005:Aplp1 UTSW 7 30436045 critical splice acceptor site probably null
Z1177:Aplp1 UTSW 7 30438189 missense probably benign 0.44
Z1177:Aplp1 UTSW 7 30438279 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATAGCCATGCCTCTGAAGTTCCC -3'
(R):5'- TCCACTGGAGCAGTATGAGCAAAAG -3'

Sequencing Primer
(F):5'- CATGGCTGATAGTCCCATAGG -3'
(R):5'- CAGTATGAGCAAAAGGTAAGTGAGTG -3'
Posted On2013-08-06