Incidental Mutation 'R8396:Ntsr2'
ID647621
Institutional Source Beutler Lab
Gene Symbol Ntsr2
Ensembl Gene ENSMUSG00000020591
Gene Nameneurotensin receptor 2
SynonymsNTRL, NT2R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8396 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location16653382-16660227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16656820 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 283 (H283R)
Ref Sequence ENSEMBL: ENSMUSP00000106693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111064] [ENSMUST00000220892] [ENSMUST00000221049] [ENSMUST00000221596]
Predicted Effect probably damaging
Transcript: ENSMUST00000111064
AA Change: H283R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106693
Gene: ENSMUSG00000020591
AA Change: H283R

DomainStartEndE-ValueType
Pfam:7tm_1 49 358 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220892
Predicted Effect probably benign
Transcript: ENSMUST00000221049
Predicted Effect probably damaging
Transcript: ENSMUST00000221596
AA Change: H252R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit abnormal thermal nociception. Mice homozygous for different knock-out allele exhibit increased prepulse inhibition and decreased accoustic startle response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef3 A G 10: 18,652,532 probably null Het
Arid1a T C 4: 133,752,662 Y317C probably damaging Het
Asxl2 A G 12: 3,502,220 T1321A probably benign Het
Bckdk A G 7: 127,905,759 Y129C probably damaging Het
Birc2 A G 9: 7,834,300 V60A probably benign Het
Bmp8a T C 4: 123,325,159 H152R probably benign Het
C3 T C 17: 57,221,029 H730R probably benign Het
Ccser1 T A 6: 61,312,104 V417E probably benign Het
Cfap58 T A 19: 48,029,101 M800K probably damaging Het
Clip1 A G 5: 123,642,564 L352P probably damaging Het
Cr2 A G 1: 195,158,068 L522P probably damaging Het
Ctcf T A 8: 105,666,747 H347Q possibly damaging Het
Gm13271 A T 4: 88,755,081 M72L probably benign Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Ighv5-8 C T 12: 113,655,193 A76V unknown Het
Irx5 G A 8: 92,360,334 G298D probably benign Het
Klf5 T C 14: 99,302,234 I361T possibly damaging Het
Lsm11 G A 11: 45,944,764 A50V probably benign Het
Map1b T C 13: 99,434,113 K700R unknown Het
Muc5b A T 7: 141,851,815 T954S unknown Het
Nhsl1 A G 10: 18,525,162 N678S probably benign Het
Npsr1 T A 9: 24,310,081 I277N possibly damaging Het
Obscn A T 11: 59,003,003 I6746N probably benign Het
Obsl1 T C 1: 75,503,706 T425A probably benign Het
Pag1 T A 3: 9,694,052 E335D probably benign Het
Parp3 T A 9: 106,474,248 Q223L probably benign Het
Pogz T C 3: 94,878,750 V883A probably benign Het
Rsbn1l A T 5: 20,927,667 M198K probably benign Het
Sh3bgr A G 16: 96,206,480 probably null Het
Shc4 A G 2: 125,629,697 I600T probably damaging Het
Slc26a1 T C 5: 108,673,849 H74R probably benign Het
Slc7a11 A C 3: 50,384,129 I277S possibly damaging Het
Tep1 G T 14: 50,837,072 T1832N probably benign Het
Terf2 A G 8: 107,082,981 probably null Het
Tle4 G A 19: 14,454,959 Q458* probably null Het
Trim34b A T 7: 104,329,876 D110V probably damaging Het
Usp9y A T Y: 1,308,034 N2267K possibly damaging Het
Vmn2r50 G A 7: 10,047,712 Q369* probably null Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp229 T C 17: 21,746,096 S436P probably damaging Het
Other mutations in Ntsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Ntsr2 APN 12 16659848 missense probably damaging 0.97
IGL01973:Ntsr2 APN 12 16656774 missense probably benign 0.01
IGL02202:Ntsr2 APN 12 16653660 missense probably damaging 0.99
IGL02493:Ntsr2 APN 12 16658389 missense possibly damaging 0.90
IGL02837:Ntsr2 UTSW 12 16653875 missense probably damaging 0.99
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0381:Ntsr2 UTSW 12 16659718 nonsense probably null
R0437:Ntsr2 UTSW 12 16653695 missense probably damaging 1.00
R0666:Ntsr2 UTSW 12 16653980 missense probably benign 0.28
R0751:Ntsr2 UTSW 12 16654030 missense probably damaging 1.00
R1919:Ntsr2 UTSW 12 16654110 missense probably damaging 0.96
R2190:Ntsr2 UTSW 12 16654017 missense probably damaging 1.00
R5323:Ntsr2 UTSW 12 16659933 missense probably benign 0.00
R5358:Ntsr2 UTSW 12 16654082 missense probably damaging 1.00
R6282:Ntsr2 UTSW 12 16658425 missense probably damaging 1.00
R6358:Ntsr2 UTSW 12 16656768 missense probably benign 0.29
R6523:Ntsr2 UTSW 12 16656696 missense probably benign 0.05
R6837:Ntsr2 UTSW 12 16659709 missense probably benign 0.04
R8418:Ntsr2 UTSW 12 16656661 missense possibly damaging 0.83
RF017:Ntsr2 UTSW 12 16659765 missense probably damaging 0.99
X0064:Ntsr2 UTSW 12 16656757 missense probably damaging 1.00
Z1177:Ntsr2 UTSW 12 16653662 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GATCACTGTCAACCACCTGG -3'
(R):5'- GTGTGGACCTGTAATTTCATGC -3'

Sequencing Primer
(F):5'- ACCTGGTGGCCCTCTAC -3'
(R):5'- AACTATCCCGTTGTGCTTTTGAG -3'
Posted On2020-09-02