Incidental Mutation 'R8397:Patl2'
ID 647638
Institutional Source Beutler Lab
Gene Symbol Patl2
Ensembl Gene ENSMUSG00000027233
Gene Name protein associated with topoisomerase II homolog 2 (yeast)
Synonyms Pat1a, 4930424G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R8397 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 122120108-122186189 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 122125273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 261 (S261A)
Ref Sequence ENSEMBL: ENSMUSP00000028665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665]
AlphaFold A2ARM1
Predicted Effect probably damaging
Transcript: ENSMUST00000028665
AA Change: S261A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233
AA Change: S261A

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,040,513 T499A probably benign Het
Ahsa1 G T 12: 87,273,677 E311* probably null Het
Apol9a C T 15: 77,404,613 V185I probably benign Het
Arhgap27 T A 11: 103,333,247 D580V probably damaging Het
Arpp21 A C 9: 112,149,372 S298A possibly damaging Het
B4galnt2 T A 11: 95,866,163 T481S probably benign Het
Cct8 G A 16: 87,493,763 R59C possibly damaging Het
Cdhr5 C T 7: 141,271,888 G501E possibly damaging Het
Chka G A 19: 3,852,414 probably null Het
Cit C A 5: 115,886,797 N366K probably benign Het
Dennd4a A T 9: 64,889,109 M806L probably benign Het
Dhx9 T A 1: 153,468,911 H510L probably damaging Het
Esyt3 C T 9: 99,327,913 V305I probably benign Het
Fbxo40 A T 16: 36,970,623 C42S probably damaging Het
Fbxw26 T C 9: 109,732,647 M160V probably damaging Het
Frem2 A G 3: 53,653,141 V1315A probably benign Het
Gbp9 T A 5: 105,083,598 N374I possibly damaging Het
Gm11992 T G 11: 9,061,305 S249A probably damaging Het
Gm14418 T A 2: 177,387,293 Q303L probably damaging Het
Hectd4 C A 5: 121,259,894 P295Q probably damaging Het
Kdm2b T C 5: 122,880,516 N954D probably benign Het
Klf15 C T 6: 90,466,796 H118Y probably damaging Het
Lrit2 G T 14: 37,069,077 A238S probably damaging Het
Man2c1 A C 9: 57,135,499 M218L probably benign Het
Map3k1 T A 13: 111,755,604 H1039L probably damaging Het
Map3k9 A G 12: 81,722,362 S971P probably benign Het
Map4k3 C T 17: 80,664,017 V74I probably damaging Het
Mars A T 10: 127,300,499 S486T possibly damaging Het
Mettl13 A T 1: 162,544,318 S327R possibly damaging Het
Mkks G A 2: 136,881,003 T78M possibly damaging Het
Mst1 C T 9: 108,081,499 probably benign Het
Myh1 G T 11: 67,221,639 A1811S probably damaging Het
Myh13 A G 11: 67,350,287 H830R possibly damaging Het
Nek4 A G 14: 30,970,548 D443G possibly damaging Het
Nf1 T C 11: 79,547,692 L137P probably damaging Het
Nipsnap3b T C 4: 53,012,049 probably null Het
Nos1ap G T 1: 170,327,625 P220T unknown Het
Nrxn3 T A 12: 90,331,809 I368N probably benign Het
Nup133 T A 8: 123,922,417 Q562L probably benign Het
Nup214 T A 2: 31,990,254 L342Q probably damaging Het
Nxn A G 11: 76,272,406 S264P probably damaging Het
Olfr739 G T 14: 50,424,680 D54Y probably damaging Het
Otud4 T C 8: 79,669,298 S567P probably benign Het
Pcdh15 C T 10: 74,291,033 P315S probably damaging Het
Pcm1 T A 8: 41,283,579 H827Q probably damaging Het
Pirb G A 7: 3,716,046 L615F probably damaging Het
Ppp1r12c T A 7: 4,489,769 H236L probably damaging Het
Prkd1 C T 12: 50,392,892 G384E probably benign Het
Rmnd1 C A 10: 4,427,278 E134* probably null Het
Rusc2 T A 4: 43,424,206 H1090Q possibly damaging Het
Sema5b A C 16: 35,651,321 Y428S possibly damaging Het
Slc2a8 T A 2: 32,975,998 I301L probably benign Het
Slc38a11 C T 2: 65,330,291 V320M probably damaging Het
Slc4a5 G T 6: 83,289,326 probably null Het
Slc7a6 T C 8: 106,193,533 I320T probably damaging Het
Slc8a3 A G 12: 81,199,768 I837T probably benign Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Tlr3 A T 8: 45,398,859 F334I possibly damaging Het
Unc13b A G 4: 43,217,290 I530V probably benign Het
Vmn2r68 T C 7: 85,237,514 D64G possibly damaging Het
Zfp157 T A 5: 138,456,256 Y239N probably damaging Het
Other mutations in Patl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Patl2 APN 2 122123810 missense probably benign 0.19
IGL01780:Patl2 APN 2 122121846 missense probably damaging 1.00
IGL02604:Patl2 APN 2 122125333 missense possibly damaging 0.80
IGL02713:Patl2 APN 2 122125847 missense probably benign 0.01
IGL02990:Patl2 APN 2 122124497 critical splice acceptor site probably null
FR4304:Patl2 UTSW 2 122126135 small insertion probably benign
FR4548:Patl2 UTSW 2 122126135 small insertion probably benign
FR4737:Patl2 UTSW 2 122126136 small insertion probably benign
FR4737:Patl2 UTSW 2 122126144 nonsense probably null
FR4737:Patl2 UTSW 2 122126145 small insertion probably benign
FR4976:Patl2 UTSW 2 122126139 small insertion probably benign
FR4976:Patl2 UTSW 2 122126141 small insertion probably benign
FR4976:Patl2 UTSW 2 122126144 small insertion probably benign
FR4976:Patl2 UTSW 2 122126145 small insertion probably benign
R0001:Patl2 UTSW 2 122125710 splice site probably benign
R0002:Patl2 UTSW 2 122125710 splice site probably benign
R0540:Patl2 UTSW 2 122126669 missense probably benign
R0570:Patl2 UTSW 2 122125308 missense probably damaging 0.99
R0607:Patl2 UTSW 2 122126669 missense probably benign
R1463:Patl2 UTSW 2 122123735 missense probably benign 0.38
R2992:Patl2 UTSW 2 122125754 missense probably damaging 0.97
R4329:Patl2 UTSW 2 122127537 missense probably benign 0.01
R4583:Patl2 UTSW 2 122126745 missense probably benign 0.00
R4737:Patl2 UTSW 2 122125306 missense probably damaging 1.00
R4965:Patl2 UTSW 2 122128848 nonsense probably null
R5091:Patl2 UTSW 2 122123802 missense probably benign 0.01
R5256:Patl2 UTSW 2 122128887 missense probably damaging 1.00
R5450:Patl2 UTSW 2 122125281 missense probably benign 0.00
R5990:Patl2 UTSW 2 122124484 missense probably damaging 1.00
R6028:Patl2 UTSW 2 122126137 missense possibly damaging 0.76
R6107:Patl2 UTSW 2 122127486 missense probably damaging 0.98
R6597:Patl2 UTSW 2 122186164 start gained probably benign
R6969:Patl2 UTSW 2 122128929 missense possibly damaging 0.52
R7131:Patl2 UTSW 2 122121782 critical splice donor site probably null
R7436:Patl2 UTSW 2 122127525 missense probably benign 0.00
R7718:Patl2 UTSW 2 122126774 splice site probably null
R7852:Patl2 UTSW 2 122179109 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGATACAGCGTCAATAGCTCGG -3'
(R):5'- TCCTTACCTACCCTGGGAATG -3'

Sequencing Primer
(F):5'- TCAATAGCTCGGCGAGGG -3'
(R):5'- GAATGTAGGCATGTCCACCTCTG -3'
Posted On 2020-09-02