Incidental Mutation 'R8397:Rusc2'
ID647643
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R8397 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43424206 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1090 (H1090Q)
Ref Sequence ENSEMBL: ENSMUSP00000038379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000149676] [ENSMUST00000171134] [ENSMUST00000173682]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035645
AA Change: H1090Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: H1090Q

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052829
SMART Domains Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 47 2.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098106
AA Change: H1090Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: H1090Q

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107928
SMART Domains Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.3e-20 PFAM
Pfam:DUF2475 212 251 6.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107929
SMART Domains Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.5e-20 PFAM
Pfam:DUF2475 232 271 7.7e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131668
AA Change: H1090Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: H1090Q

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect probably benign
Transcript: ENSMUST00000149676
Predicted Effect probably benign
Transcript: ENSMUST00000155080
Predicted Effect probably benign
Transcript: ENSMUST00000171134
SMART Domains Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,040,513 T499A probably benign Het
Ahsa1 G T 12: 87,273,677 E311* probably null Het
Apol9a C T 15: 77,404,613 V185I probably benign Het
Arhgap27 T A 11: 103,333,247 D580V probably damaging Het
Arpp21 A C 9: 112,149,372 S298A possibly damaging Het
B4galnt2 T A 11: 95,866,163 T481S probably benign Het
Cct8 G A 16: 87,493,763 R59C possibly damaging Het
Cdhr5 C T 7: 141,271,888 G501E possibly damaging Het
Chka G A 19: 3,852,414 probably null Het
Cit C A 5: 115,886,797 N366K probably benign Het
Dennd4a A T 9: 64,889,109 M806L probably benign Het
Dhx9 T A 1: 153,468,911 H510L probably damaging Het
Esyt3 C T 9: 99,327,913 V305I probably benign Het
Fbxo40 A T 16: 36,970,623 C42S probably damaging Het
Fbxw26 T C 9: 109,732,647 M160V probably damaging Het
Frem2 A G 3: 53,653,141 V1315A probably benign Het
Gbp9 T A 5: 105,083,598 N374I possibly damaging Het
Gm11992 T G 11: 9,061,305 S249A probably damaging Het
Gm14418 T A 2: 177,387,293 Q303L probably damaging Het
Hectd4 C A 5: 121,259,894 P295Q probably damaging Het
Kdm2b T C 5: 122,880,516 N954D probably benign Het
Klf15 C T 6: 90,466,796 H118Y probably damaging Het
Lrit2 G T 14: 37,069,077 A238S probably damaging Het
Man2c1 A C 9: 57,135,499 M218L probably benign Het
Map3k1 T A 13: 111,755,604 H1039L probably damaging Het
Map3k9 A G 12: 81,722,362 S971P probably benign Het
Map4k3 C T 17: 80,664,017 V74I probably damaging Het
Mars A T 10: 127,300,499 S486T possibly damaging Het
Mettl13 A T 1: 162,544,318 S327R possibly damaging Het
Mkks G A 2: 136,881,003 T78M possibly damaging Het
Mst1 C T 9: 108,081,499 probably benign Het
Myh1 G T 11: 67,221,639 A1811S probably damaging Het
Myh13 A G 11: 67,350,287 H830R possibly damaging Het
Nek4 A G 14: 30,970,548 D443G possibly damaging Het
Nf1 T C 11: 79,547,692 L137P probably damaging Het
Nipsnap3b T C 4: 53,012,049 probably null Het
Nos1ap G T 1: 170,327,625 P220T unknown Het
Nrxn3 T A 12: 90,331,809 I368N probably benign Het
Nup133 T A 8: 123,922,417 Q562L probably benign Het
Nup214 T A 2: 31,990,254 L342Q probably damaging Het
Nxn A G 11: 76,272,406 S264P probably damaging Het
Olfr739 G T 14: 50,424,680 D54Y probably damaging Het
Otud4 T C 8: 79,669,298 S567P probably benign Het
Patl2 A C 2: 122,125,273 S261A probably damaging Het
Pcdh15 C T 10: 74,291,033 P315S probably damaging Het
Pcm1 T A 8: 41,283,579 H827Q probably damaging Het
Pirb G A 7: 3,716,046 L615F probably damaging Het
Ppp1r12c T A 7: 4,489,769 H236L probably damaging Het
Prkd1 C T 12: 50,392,892 G384E probably benign Het
Rmnd1 C A 10: 4,427,278 E134* probably null Het
Sema5b A C 16: 35,651,321 Y428S possibly damaging Het
Slc2a8 T A 2: 32,975,998 I301L probably benign Het
Slc38a11 C T 2: 65,330,291 V320M probably damaging Het
Slc4a5 G T 6: 83,289,326 probably null Het
Slc7a6 T C 8: 106,193,533 I320T probably damaging Het
Slc8a3 A G 12: 81,199,768 I837T probably benign Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Tlr3 A T 8: 45,398,859 F334I possibly damaging Het
Unc13b A G 4: 43,217,290 I530V probably benign Het
Vmn2r68 T C 7: 85,237,514 D64G possibly damaging Het
Zfp157 T A 5: 138,456,256 Y239N probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43425486 missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1416:Rusc2 UTSW 4 43421617 missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43426046 missense probably benign
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 splice site probably null
R5540:Rusc2 UTSW 4 43423975 missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7491:Rusc2 UTSW 4 43426528 missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R7710:Rusc2 UTSW 4 43416119 missense probably benign 0.07
R8052:Rusc2 UTSW 4 43421851 missense probably benign
R8061:Rusc2 UTSW 4 43422492 missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43423747 missense possibly damaging 0.54
R8319:Rusc2 UTSW 4 43425378 missense probably damaging 1.00
R8355:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8455:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8553:Rusc2 UTSW 4 43416508 missense probably benign 0.05
R8725:Rusc2 UTSW 4 43401351 intron probably benign
R8725:Rusc2 UTSW 4 43415396 missense probably damaging 0.99
R8727:Rusc2 UTSW 4 43401351 intron probably benign
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGAAGTACTTGTGCCCTGC -3'
(R):5'- GTAAAGGCATCCCAAGGAGC -3'

Sequencing Primer
(F):5'- ACTCAAGGCCTTCGTACTGGATG -3'
(R):5'- CAGACACCCCTCCGGTCTC -3'
Posted On2020-09-02