Mutagenetix > Incidental Mutation

Incidental Mutation 'R0021:5830411N06Rik'

64765

Institutional Source

Beutler Lab

Gene Symbol

5830411N06Rik

Ensembl Gene

ENSMUSG00000054672

Gene Name

RIKEN cDNA 5830411N06 gene

Synonyms

Scart2

MMRRC Submission

038316-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0021 (G1)

Quality Score

149

Status

Validated

Chromosome

Chromosomal Location

140247284-140300736 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 140296397 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 594 (R594H)

Ref Sequence

ENSEMBL: ENSMUSP00000131905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]

AlphaFold

B3F5L4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059882

SMART Domains

Protein: ENSMUSP00000061346
Gene: ENSMUSG00000054672

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
SR	238	336	1.65e-34	SMART
SR	340	440	4.53e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093984
AA Change: R478H

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: R478H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
SR	238	336	1.65e-34	SMART
SR	340	440	4.53e-32	SMART
SR	446	546	8.78e-30	SMART
SR	551	651	1.26e-53	SMART
SR	656	756	2.88e-16	SMART
SR	783	883	7.62e-48	SMART
transmembrane domain	903	925	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164583
AA Change: R594H

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: R594H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
Blast:SR	291	349	5e-12	BLAST
SR	354	452	1.65e-34	SMART
SR	456	556	4.53e-32	SMART
SR	562	662	8.78e-30	SMART
SR	667	767	1.26e-53	SMART
SR	772	872	2.88e-16	SMART
SR	899	999	7.62e-48	SMART
transmembrane domain	1019	1041	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210212

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211749

Meta Mutation Damage Score

0.1738

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.8%

Validation Efficiency

97% (60/62)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310016G11Rik	A	G	7: 44,677,196		noncoding transcript	Het
Abcc5	T	A	16: 20,378,661	K647*	probably null	Het
Aplp1	A	G	7: 30,435,816		probably benign	Het
Arhgef25	A	G	10: 127,189,554	I43T	probably benign	Het
AU019823	A	C	9: 50,610,425	D65E	probably damaging	Het
BC003965	A	G	17: 25,184,983	E99G	possibly damaging	Het
Brinp3	T	G	1: 146,901,451	S545R	probably benign	Het
Btnl1	A	G	17: 34,379,494	E28G	probably benign	Het
C5ar2	A	G	7: 16,237,676	F109L	probably benign	Het
D630045J12Rik	G	A	6: 38,183,967	Q1081*	probably null	Het
Dhx36	T	C	3: 62,477,595	I699V	possibly damaging	Het
Dnah9	A	G	11: 65,969,979	I2855T	probably benign	Het
Dock8	T	C	19: 25,163,047	I1317T	probably benign	Het
Galnt11	A	T	5: 25,248,857	D27V	probably damaging	Het
Gm5134	T	A	10: 75,993,884	C335S	probably damaging	Het
Hdhd2	A	T	18: 76,970,615	K227N	probably damaging	Het
Impg1	A	T	9: 80,435,426	L36Q	probably damaging	Het
Krtcap3	A	G	5: 31,252,959	H227R	probably benign	Het
Lrrc7	A	G	3: 158,160,661	Y1148H	probably damaging	Het
Map2k4	A	G	11: 65,712,284	I174T	probably damaging	Het
Mef2c	C	A	13: 83,656,240	L282M	probably damaging	Het
Nqo2	T	C	13: 33,981,507	I129T	probably benign	Het
Pdgfrb	T	A	18: 61,064,926		probably benign	Het
Phf7	C	T	14: 31,238,486		probably benign	Het
Plac8	T	A	5: 100,556,568	T88S	probably benign	Het
Pou2f1	G	A	1: 165,876,018	T654M	probably damaging	Het
Ptprk	T	A	10: 28,592,895	V1425E	probably damaging	Het
Saal1	A	T	7: 46,692,892	S376T	probably damaging	Het
Serpini1	T	C	3: 75,619,313	Y291H	probably damaging	Het
Siah2	T	C	3: 58,676,292	H191R	probably benign	Het
Spaca6	T	A	17: 17,838,236	Y39*	probably null	Het
Tbc1d10a	T	C	11: 4,213,680	C277R	probably damaging	Het
Trim45	A	T	3: 100,925,420	D323V	probably damaging	Het
Trim55	A	C	3: 19,644,702	M32L	probably benign	Het
Unc5b	T	C	10: 60,778,919	T200A	probably benign	Het
V1rd19	A	T	7: 24,003,604	D165V	probably damaging	Het

Other mutations in 5830411N06Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:5830411N06Rik	APN	7	140294842	missense	probably damaging	0.99
IGL01101:5830411N06Rik	APN	7	140296104	missense	probably benign	0.35
IGL01120:5830411N06Rik	APN	7	140296559	missense	probably benign	0.02
IGL01958:5830411N06Rik	APN	7	140274127	missense	probably damaging	1.00
IGL02150:5830411N06Rik	APN	7	140297859	missense	possibly damaging	0.84
IGL02193:5830411N06Rik	APN	7	140249000	missense	probably benign	0.17
IGL02239:5830411N06Rik	APN	7	140295843	missense	probably damaging	1.00
IGL02335:5830411N06Rik	APN	7	140296540	missense	probably damaging	1.00
IGL02569:5830411N06Rik	APN	7	140298362	missense	probably benign	0.01
IGL02993:5830411N06Rik	APN	7	140296573	missense	probably benign	0.07
IGL03261:5830411N06Rik	APN	7	140294833	missense	probably benign	0.00
IGL03365:5830411N06Rik	APN	7	140296769	missense	probably damaging	1.00
IGL03399:5830411N06Rik	APN	7	140247956	missense	probably benign	0.00
IGL03052:5830411N06Rik	UTSW	7	140248914	missense	probably damaging	1.00
PIT4791001:5830411N06Rik	UTSW	7	140274062	missense	possibly damaging	0.53
R0021:5830411N06Rik	UTSW	7	140296397	missense	probably benign	0.15
R0347:5830411N06Rik	UTSW	7	140297854	missense	probably damaging	1.00
R0374:5830411N06Rik	UTSW	7	140248961	missense	probably damaging	1.00
R0639:5830411N06Rik	UTSW	7	140247959	missense	probably benign	0.01
R0667:5830411N06Rik	UTSW	7	140261537	missense	possibly damaging	0.73
R0789:5830411N06Rik	UTSW	7	140248220	missense	probably damaging	1.00
R0959:5830411N06Rik	UTSW	7	140294791	missense	probably damaging	1.00
R1316:5830411N06Rik	UTSW	7	140299670	missense	probably benign	0.09
R1764:5830411N06Rik	UTSW	7	140297265	missense	probably benign	0.00
R2247:5830411N06Rik	UTSW	7	140249129	missense	probably null	0.96
R2379:5830411N06Rik	UTSW	7	140299769	missense	probably benign	0.15
R4112:5830411N06Rik	UTSW	7	140298368	nonsense	probably null
R4114:5830411N06Rik	UTSW	7	140297910	missense	probably damaging	1.00
R4346:5830411N06Rik	UTSW	7	140247965	missense	probably damaging	0.97
R4836:5830411N06Rik	UTSW	7	140299108	missense	probably benign
R4956:5830411N06Rik	UTSW	7	140298362	missense	probably benign	0.00
R5208:5830411N06Rik	UTSW	7	140298036	missense	probably benign	0.00
R5571:5830411N06Rik	UTSW	7	140249123	missense	probably damaging	1.00
R5583:5830411N06Rik	UTSW	7	140296826	missense	probably damaging	1.00
R5645:5830411N06Rik	UTSW	7	140248940	missense	possibly damaging	0.95
R6183:5830411N06Rik	UTSW	7	140296034	missense	possibly damaging	0.82
R6995:5830411N06Rik	UTSW	7	140261601	missense	probably benign
R7436:5830411N06Rik	UTSW	7	140261607	missense	probably benign
R7621:5830411N06Rik	UTSW	7	140296829	missense	probably damaging	1.00
R7662:5830411N06Rik	UTSW	7	140294812	missense	possibly damaging	0.58
R7669:5830411N06Rik	UTSW	7	140296321	missense	possibly damaging	0.47
R7686:5830411N06Rik	UTSW	7	140249052	missense	probably benign	0.00
R7985:5830411N06Rik	UTSW	7	140296893	missense	probably damaging	1.00
R8330:5830411N06Rik	UTSW	7	140296318	nonsense	probably null
R8843:5830411N06Rik	UTSW	7	140249000	missense	possibly damaging	0.93
R8888:5830411N06Rik	UTSW	7	140261619	missense	possibly damaging	0.93
R8895:5830411N06Rik	UTSW	7	140261619	missense	possibly damaging	0.93
R9044:5830411N06Rik	UTSW	7	140248097	missense	probably damaging	1.00
R9142:5830411N06Rik	UTSW	7	140297893	missense	probably damaging	1.00
R9152:5830411N06Rik	UTSW	7	140297343	missense	possibly damaging	0.55
R9470:5830411N06Rik	UTSW	7	140247432	missense	probably benign	0.07
R9509:5830411N06Rik	UTSW	7	140299731	nonsense	probably null
R9522:5830411N06Rik	UTSW	7	140274074	missense	possibly damaging	0.73
R9755:5830411N06Rik	UTSW	7	140261631	critical splice donor site	probably null
R9794:5830411N06Rik	UTSW	7	140294803	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTGGAAGGTCCCATCAGGACAG -3'
(R):5'- GCAGATACATTGCACTGGGTCAGG -3'

Sequencing Primer
(F):5'- CCATCAGGACAGATGTGTTTCAC -3'
(R):5'- TCAGGTGGGTCTCAGAGC -3'

Posted On

2013-08-06