Mutagenetix > Incidental Mutation

Incidental Mutation 'R8397:Pirb'

647652

Institutional Source

Beutler Lab

Gene Symbol

Pirb

Ensembl Gene

ENSMUSG00000058818

Gene Name

paired Ig-like receptor B

Synonyms

Lilrb3, Gp91

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8397 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3711409-3720391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 3716046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 615 (L615F)

Ref Sequence

ENSEMBL: ENSMUSP00000077546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078451]

AlphaFold

P97484

Predicted Effect

probably damaging
Transcript: ENSMUST00000078451
AA Change: L615F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818
AA Change: L615F

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	34	118	1.8e-3	SMART
IG	129	315	1.2e-4	SMART
IG_like	237	302	6.2e-4	SMART
IG_like	328	415	3.4e-2	SMART
IG_like	435	502	1e-2	SMART
IG	529	618	3.6e-5	SMART
low complexity region	624	637	N/A	INTRINSIC
transmembrane domain	641	663	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg3	A	G	8: 95,040,513	T499A	probably benign	Het
Ahsa1	G	T	12: 87,273,677	E311*	probably null	Het
Apol9a	C	T	15: 77,404,613	V185I	probably benign	Het
Arhgap27	T	A	11: 103,333,247	D580V	probably damaging	Het
Arpp21	A	C	9: 112,149,372	S298A	possibly damaging	Het
B4galnt2	T	A	11: 95,866,163	T481S	probably benign	Het
Cct8	G	A	16: 87,493,763	R59C	possibly damaging	Het
Cdhr5	C	T	7: 141,271,888	G501E	possibly damaging	Het
Chka	G	A	19: 3,852,414		probably null	Het
Cit	C	A	5: 115,886,797	N366K	probably benign	Het
Dennd4a	A	T	9: 64,889,109	M806L	probably benign	Het
Dhx9	T	A	1: 153,468,911	H510L	probably damaging	Het
Esyt3	C	T	9: 99,327,913	V305I	probably benign	Het
Fbxo40	A	T	16: 36,970,623	C42S	probably damaging	Het
Fbxw26	T	C	9: 109,732,647	M160V	probably damaging	Het
Frem2	A	G	3: 53,653,141	V1315A	probably benign	Het
Gbp9	T	A	5: 105,083,598	N374I	possibly damaging	Het
Gm11992	T	G	11: 9,061,305	S249A	probably damaging	Het
Gm14418	T	A	2: 177,387,293	Q303L	probably damaging	Het
Hectd4	C	A	5: 121,259,894	P295Q	probably damaging	Het
Kdm2b	T	C	5: 122,880,516	N954D	probably benign	Het
Klf15	C	T	6: 90,466,796	H118Y	probably damaging	Het
Lrit2	G	T	14: 37,069,077	A238S	probably damaging	Het
Man2c1	A	C	9: 57,135,499	M218L	probably benign	Het
Map3k1	T	A	13: 111,755,604	H1039L	probably damaging	Het
Map3k9	A	G	12: 81,722,362	S971P	probably benign	Het
Map4k3	C	T	17: 80,664,017	V74I	probably damaging	Het
Mars	A	T	10: 127,300,499	S486T	possibly damaging	Het
Mettl13	A	T	1: 162,544,318	S327R	possibly damaging	Het
Mkks	G	A	2: 136,881,003	T78M	possibly damaging	Het
Mst1	C	T	9: 108,081,499		probably benign	Het
Myh1	G	T	11: 67,221,639	A1811S	probably damaging	Het
Myh13	A	G	11: 67,350,287	H830R	possibly damaging	Het
Nek4	A	G	14: 30,970,548	D443G	possibly damaging	Het
Nf1	T	C	11: 79,547,692	L137P	probably damaging	Het
Nipsnap3b	T	C	4: 53,012,049		probably null	Het
Nos1ap	G	T	1: 170,327,625	P220T	unknown	Het
Nrxn3	T	A	12: 90,331,809	I368N	probably benign	Het
Nup133	T	A	8: 123,922,417	Q562L	probably benign	Het
Nup214	T	A	2: 31,990,254	L342Q	probably damaging	Het
Nxn	A	G	11: 76,272,406	S264P	probably damaging	Het
Olfr739	G	T	14: 50,424,680	D54Y	probably damaging	Het
Otud4	T	C	8: 79,669,298	S567P	probably benign	Het
Patl2	A	C	2: 122,125,273	S261A	probably damaging	Het
Pcdh15	C	T	10: 74,291,033	P315S	probably damaging	Het
Pcm1	T	A	8: 41,283,579	H827Q	probably damaging	Het
Ppp1r12c	T	A	7: 4,489,769	H236L	probably damaging	Het
Prkd1	C	T	12: 50,392,892	G384E	probably benign	Het
Rmnd1	C	A	10: 4,427,278	E134*	probably null	Het
Rusc2	T	A	4: 43,424,206	H1090Q	possibly damaging	Het
Sema5b	A	C	16: 35,651,321	Y428S	possibly damaging	Het
Slc2a8	T	A	2: 32,975,998	I301L	probably benign	Het
Slc38a11	C	T	2: 65,330,291	V320M	probably damaging	Het
Slc4a5	G	T	6: 83,289,326		probably null	Het
Slc7a6	T	C	8: 106,193,533	I320T	probably damaging	Het
Slc8a3	A	G	12: 81,199,768	I837T	probably benign	Het
Spag1	C	T	15: 36,197,749	R286*	probably null	Het
Tlr3	A	T	8: 45,398,859	F334I	possibly damaging	Het
Unc13b	A	G	4: 43,217,290	I530V	probably benign	Het
Vmn2r68	T	C	7: 85,237,514	D64G	possibly damaging	Het
Zfp157	T	A	5: 138,456,256	Y239N	probably damaging	Het

Other mutations in Pirb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Pirb	APN	7	3717406	missense	probably damaging	0.99
IGL01744:Pirb	APN	7	3717176	nonsense	probably null
IGL01755:Pirb	APN	7	3717170	missense	probably benign	0.16
IGL02580:Pirb	APN	7	3714206	splice site	probably null
IGL02941:Pirb	APN	7	3717378	missense	probably damaging	1.00
R0394:Pirb	UTSW	7	3719248	missense	probably benign	0.08
R0680:Pirb	UTSW	7	3717361	missense	possibly damaging	0.94
R0787:Pirb	UTSW	7	3717638	missense	probably benign
R0790:Pirb	UTSW	7	3717638	missense	probably benign
R0832:Pirb	UTSW	7	3717638	missense	probably benign
R1124:Pirb	UTSW	7	3719732	missense	probably benign	0.02
R1178:Pirb	UTSW	7	3717638	missense	probably benign
R1180:Pirb	UTSW	7	3717638	missense	probably benign
R1181:Pirb	UTSW	7	3717638	missense	probably benign
R1281:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1343:Pirb	UTSW	7	3717638	missense	probably benign
R1579:Pirb	UTSW	7	3717638	missense	probably benign
R1699:Pirb	UTSW	7	3717638	missense	probably benign
R1768:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1909:Pirb	UTSW	7	3714588	missense	probably benign	0.33
R1965:Pirb	UTSW	7	3717638	missense	probably benign
R1966:Pirb	UTSW	7	3717638	missense	probably benign
R2004:Pirb	UTSW	7	3717638	missense	probably benign
R2305:Pirb	UTSW	7	3712991	missense	probably benign	0.00
R2931:Pirb	UTSW	7	3717206	missense	probably benign	0.08
R3858:Pirb	UTSW	7	3717663	missense	possibly damaging	0.54
R3928:Pirb	UTSW	7	3717638	missense	probably benign
R3938:Pirb	UTSW	7	3717638	missense	probably benign
R4119:Pirb	UTSW	7	3717575	missense	probably damaging	1.00
R4174:Pirb	UTSW	7	3716032	critical splice donor site	probably null
R4248:Pirb	UTSW	7	3719298	missense	probably damaging	1.00
R4827:Pirb	UTSW	7	3717603	missense	probably benign
R4828:Pirb	UTSW	7	3717603	missense	probably benign
R4829:Pirb	UTSW	7	3717603	missense	probably benign
R4830:Pirb	UTSW	7	3717603	missense	probably benign
R4870:Pirb	UTSW	7	3712662	missense	probably benign	0.00
R4909:Pirb	UTSW	7	3719362	nonsense	probably null
R5146:Pirb	UTSW	7	3712621	utr 3 prime	probably benign
R5244:Pirb	UTSW	7	3716063	missense	probably benign	0.32
R5323:Pirb	UTSW	7	3716599	missense	possibly damaging	0.85
R5921:Pirb	UTSW	7	3716694	nonsense	probably null
R6316:Pirb	UTSW	7	3717823	missense	probably damaging	1.00
R6502:Pirb	UTSW	7	3717393	missense	probably benign	0.00
R6811:Pirb	UTSW	7	3719642	missense	possibly damaging	0.91
R7216:Pirb	UTSW	7	3716274	missense	probably benign	0.00
R7275:Pirb	UTSW	7	3716178	missense	probably benign	0.00
R7327:Pirb	UTSW	7	3717188	nonsense	probably null
R7582:Pirb	UTSW	7	3713818	critical splice donor site	probably null
R7717:Pirb	UTSW	7	3717783	missense	not run
R7717:Pirb	UTSW	7	3717801	missense	not run
R7807:Pirb	UTSW	7	3719865	missense	possibly damaging	0.55
R7844:Pirb	UTSW	7	3719411	nonsense	probably null
R7947:Pirb	UTSW	7	3719858	missense	probably damaging	0.96
R8206:Pirb	UTSW	7	3712906	critical splice donor site	probably null
R8774:Pirb	UTSW	7	3717729	missense	probably damaging	1.00
R8774-TAIL:Pirb	UTSW	7	3717729	missense	probably damaging	1.00
R9033:Pirb	UTSW	7	3717585	missense	probably benign
R9275:Pirb	UTSW	7	3716860	missense	probably benign
R9452:Pirb	UTSW	7	3717618	missense	possibly damaging	0.68
R9595:Pirb	UTSW	7	3719407	missense	possibly damaging	0.78
R9605:Pirb	UTSW	7	3717618	missense	possibly damaging	0.68
R9607:Pirb	UTSW	7	3717618	missense	possibly damaging	0.68
X0025:Pirb	UTSW	7	3717268	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGATAGTCGCTACTCCAAACC -3'
(R):5'- TCATTCTGTCCAAGGAGGGATC -3'

Sequencing Primer
(F):5'- TAGTCGCTACTCCAAACCTAGATTG -3'
(R):5'- GGATCAGCCCAGCAACC -3'

Posted On

2020-09-02