Incidental Mutation 'R8397:Vmn2r68'
ID647654
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Namevomeronasal 2, receptor 68
SynonymsVmn2r68-ps, EG620697
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8397 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85221518-85237704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85237514 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 64 (D64G)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061074
AA Change: D64G

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: D64G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,040,513 T499A probably benign Het
Ahsa1 G T 12: 87,273,677 E311* probably null Het
Apol9a C T 15: 77,404,613 V185I probably benign Het
Arhgap27 T A 11: 103,333,247 D580V probably damaging Het
Arpp21 A C 9: 112,149,372 S298A possibly damaging Het
B4galnt2 T A 11: 95,866,163 T481S probably benign Het
Cct8 G A 16: 87,493,763 R59C possibly damaging Het
Cdhr5 C T 7: 141,271,888 G501E possibly damaging Het
Chka G A 19: 3,852,414 probably null Het
Cit C A 5: 115,886,797 N366K probably benign Het
Dennd4a A T 9: 64,889,109 M806L probably benign Het
Dhx9 T A 1: 153,468,911 H510L probably damaging Het
Esyt3 C T 9: 99,327,913 V305I probably benign Het
Fbxo40 A T 16: 36,970,623 C42S probably damaging Het
Fbxw26 T C 9: 109,732,647 M160V probably damaging Het
Frem2 A G 3: 53,653,141 V1315A probably benign Het
Gbp9 T A 5: 105,083,598 N374I possibly damaging Het
Gm11992 T G 11: 9,061,305 S249A probably damaging Het
Gm14418 T A 2: 177,387,293 Q303L probably damaging Het
Hectd4 C A 5: 121,259,894 P295Q probably damaging Het
Kdm2b T C 5: 122,880,516 N954D probably benign Het
Klf15 C T 6: 90,466,796 H118Y probably damaging Het
Lrit2 G T 14: 37,069,077 A238S probably damaging Het
Man2c1 A C 9: 57,135,499 M218L probably benign Het
Map3k1 T A 13: 111,755,604 H1039L probably damaging Het
Map3k9 A G 12: 81,722,362 S971P probably benign Het
Map4k3 C T 17: 80,664,017 V74I probably damaging Het
Mars A T 10: 127,300,499 S486T possibly damaging Het
Mettl13 A T 1: 162,544,318 S327R possibly damaging Het
Mkks G A 2: 136,881,003 T78M possibly damaging Het
Mst1 C T 9: 108,081,499 probably benign Het
Myh1 G T 11: 67,221,639 A1811S probably damaging Het
Myh13 A G 11: 67,350,287 H830R possibly damaging Het
Nek4 A G 14: 30,970,548 D443G possibly damaging Het
Nf1 T C 11: 79,547,692 L137P probably damaging Het
Nipsnap3b T C 4: 53,012,049 probably null Het
Nos1ap G T 1: 170,327,625 P220T unknown Het
Nrxn3 T A 12: 90,331,809 I368N probably benign Het
Nup133 T A 8: 123,922,417 Q562L probably benign Het
Nup214 T A 2: 31,990,254 L342Q probably damaging Het
Nxn A G 11: 76,272,406 S264P probably damaging Het
Olfr739 G T 14: 50,424,680 D54Y probably damaging Het
Otud4 T C 8: 79,669,298 S567P probably benign Het
Patl2 A C 2: 122,125,273 S261A probably damaging Het
Pcdh15 C T 10: 74,291,033 P315S probably damaging Het
Pcm1 T A 8: 41,283,579 H827Q probably damaging Het
Pirb G A 7: 3,716,046 L615F probably damaging Het
Ppp1r12c T A 7: 4,489,769 H236L probably damaging Het
Prkd1 C T 12: 50,392,892 G384E probably benign Het
Rmnd1 C A 10: 4,427,278 E134* probably null Het
Rusc2 T A 4: 43,424,206 H1090Q possibly damaging Het
Sema5b A C 16: 35,651,321 Y428S possibly damaging Het
Slc2a8 T A 2: 32,975,998 I301L probably benign Het
Slc38a11 C T 2: 65,330,291 V320M probably damaging Het
Slc4a5 G T 6: 83,289,326 probably null Het
Slc7a6 T C 8: 106,193,533 I320T probably damaging Het
Slc8a3 A G 12: 81,199,768 I837T probably benign Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Tlr3 A T 8: 45,398,859 F334I possibly damaging Het
Unc13b A G 4: 43,217,290 I530V probably benign Het
Zfp157 T A 5: 138,456,256 Y239N probably damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85234514 missense probably benign
R7979:Vmn2r68 UTSW 7 85234417 critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 85222214 nonsense probably null
R8349:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 85221900 missense probably benign 0.00
R8449:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 85221733 missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 85222081 missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 85222099 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCAGTCTCTCTACTAGCAAGGTC -3'
(R):5'- CTGTCATCTGGTTTCTGAAGGTTAAAC -3'

Sequencing Primer
(F):5'- GTCTCTCTACTAGCAAGGTCAATAC -3'
(R):5'- CTTATGTTTTGTCATTTGAGTGACCC -3'
Posted On2020-09-02