Incidental Mutation 'R8397:Dennd4a'
ID647663
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene NameDENN/MADD domain containing 4A
SynonymsF730015K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R8397 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64811340-64919667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64889109 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 806 (M806L)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
Predicted Effect probably benign
Transcript: ENSMUST00000038890
AA Change: M806L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: M806L

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,040,513 T499A probably benign Het
Ahsa1 G T 12: 87,273,677 E311* probably null Het
Apol9a C T 15: 77,404,613 V185I probably benign Het
Arhgap27 T A 11: 103,333,247 D580V probably damaging Het
Arpp21 A C 9: 112,149,372 S298A possibly damaging Het
B4galnt2 T A 11: 95,866,163 T481S probably benign Het
Cct8 G A 16: 87,493,763 R59C possibly damaging Het
Cdhr5 C T 7: 141,271,888 G501E possibly damaging Het
Chka G A 19: 3,852,414 probably null Het
Cit C A 5: 115,886,797 N366K probably benign Het
Dhx9 T A 1: 153,468,911 H510L probably damaging Het
Esyt3 C T 9: 99,327,913 V305I probably benign Het
Fbxo40 A T 16: 36,970,623 C42S probably damaging Het
Fbxw26 T C 9: 109,732,647 M160V probably damaging Het
Frem2 A G 3: 53,653,141 V1315A probably benign Het
Gbp9 T A 5: 105,083,598 N374I possibly damaging Het
Gm11992 T G 11: 9,061,305 S249A probably damaging Het
Gm14418 T A 2: 177,387,293 Q303L probably damaging Het
Hectd4 C A 5: 121,259,894 P295Q probably damaging Het
Kdm2b T C 5: 122,880,516 N954D probably benign Het
Klf15 C T 6: 90,466,796 H118Y probably damaging Het
Lrit2 G T 14: 37,069,077 A238S probably damaging Het
Man2c1 A C 9: 57,135,499 M218L probably benign Het
Map3k1 T A 13: 111,755,604 H1039L probably damaging Het
Map3k9 A G 12: 81,722,362 S971P probably benign Het
Map4k3 C T 17: 80,664,017 V74I probably damaging Het
Mars A T 10: 127,300,499 S486T possibly damaging Het
Mettl13 A T 1: 162,544,318 S327R possibly damaging Het
Mkks G A 2: 136,881,003 T78M possibly damaging Het
Mst1 C T 9: 108,081,499 probably benign Het
Myh1 G T 11: 67,221,639 A1811S probably damaging Het
Myh13 A G 11: 67,350,287 H830R possibly damaging Het
Nek4 A G 14: 30,970,548 D443G possibly damaging Het
Nf1 T C 11: 79,547,692 L137P probably damaging Het
Nipsnap3b T C 4: 53,012,049 probably null Het
Nos1ap G T 1: 170,327,625 P220T unknown Het
Nrxn3 T A 12: 90,331,809 I368N probably benign Het
Nup133 T A 8: 123,922,417 Q562L probably benign Het
Nup214 T A 2: 31,990,254 L342Q probably damaging Het
Nxn A G 11: 76,272,406 S264P probably damaging Het
Olfr739 G T 14: 50,424,680 D54Y probably damaging Het
Otud4 T C 8: 79,669,298 S567P probably benign Het
Patl2 A C 2: 122,125,273 S261A probably damaging Het
Pcdh15 C T 10: 74,291,033 P315S probably damaging Het
Pcm1 T A 8: 41,283,579 H827Q probably damaging Het
Pirb G A 7: 3,716,046 L615F probably damaging Het
Ppp1r12c T A 7: 4,489,769 H236L probably damaging Het
Prkd1 C T 12: 50,392,892 G384E probably benign Het
Rmnd1 C A 10: 4,427,278 E134* probably null Het
Rusc2 T A 4: 43,424,206 H1090Q possibly damaging Het
Sema5b A C 16: 35,651,321 Y428S possibly damaging Het
Slc2a8 T A 2: 32,975,998 I301L probably benign Het
Slc38a11 C T 2: 65,330,291 V320M probably damaging Het
Slc4a5 G T 6: 83,289,326 probably null Het
Slc7a6 T C 8: 106,193,533 I320T probably damaging Het
Slc8a3 A G 12: 81,199,768 I837T probably benign Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Tlr3 A T 8: 45,398,859 F334I possibly damaging Het
Unc13b A G 4: 43,217,290 I530V probably benign Het
Vmn2r68 T C 7: 85,237,514 D64G possibly damaging Het
Zfp157 T A 5: 138,456,256 Y239N probably damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64852445 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 splice site probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64897249 missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4881:Dennd4a UTSW 9 64838844 missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64871899 missense probably benign 0.04
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7056:Dennd4a UTSW 9 64906923 missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64894399 missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64897269 missense probably benign 0.01
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64873044 missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64888587 missense probably benign 0.01
R7662:Dennd4a UTSW 9 64852431 missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64906920 missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64872993 critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64852512 missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64873030 missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64888568 missense probably benign 0.01
R8089:Dennd4a UTSW 9 64849175 missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64906875 missense probably benign 0.00
R8425:Dennd4a UTSW 9 64838974 missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64886879 missense probably damaging 1.00
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTCAGCCCATAAGATCG -3'
(R):5'- TGATTGCATTGGGGTCAATACC -3'

Sequencing Primer
(F):5'- ATCGCAAAGAGGTATTCTTCTATCCC -3'
(R):5'- GCTTTCTGCATTTCAAAAAGCACTCG -3'
Posted On2020-09-02