Incidental Mutation 'R8397:Mst1'
ID647665
Institutional Source Beutler Lab
Gene Symbol Mst1
Ensembl Gene ENSMUSG00000032591
Gene Namemacrophage stimulating 1 (hepatocyte growth factor-like)
SynonymsD9H3F15S2, DNF15S2h, D3F15S2h, Hgfl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8397 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108080436-108085003 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) C to T at 108081499 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000047746] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000162886] [ENSMUST00000174504] [ENSMUST00000178267] [ENSMUST00000193254]
Predicted Effect probably benign
Transcript: ENSMUST00000035211
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081309
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161253
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000162886
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193254
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lipid-filled cytoplasmic vacuoles in hepatocytes throughout the liver lobules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,040,513 T499A probably benign Het
Ahsa1 G T 12: 87,273,677 E311* probably null Het
Apol9a C T 15: 77,404,613 V185I probably benign Het
Arhgap27 T A 11: 103,333,247 D580V probably damaging Het
Arpp21 A C 9: 112,149,372 S298A possibly damaging Het
B4galnt2 T A 11: 95,866,163 T481S probably benign Het
Cct8 G A 16: 87,493,763 R59C possibly damaging Het
Cdhr5 C T 7: 141,271,888 G501E possibly damaging Het
Chka G A 19: 3,852,414 probably null Het
Cit C A 5: 115,886,797 N366K probably benign Het
Dennd4a A T 9: 64,889,109 M806L probably benign Het
Dhx9 T A 1: 153,468,911 H510L probably damaging Het
Esyt3 C T 9: 99,327,913 V305I probably benign Het
Fbxo40 A T 16: 36,970,623 C42S probably damaging Het
Fbxw26 T C 9: 109,732,647 M160V probably damaging Het
Frem2 A G 3: 53,653,141 V1315A probably benign Het
Gbp9 T A 5: 105,083,598 N374I possibly damaging Het
Gm11992 T G 11: 9,061,305 S249A probably damaging Het
Gm14418 T A 2: 177,387,293 Q303L probably damaging Het
Hectd4 C A 5: 121,259,894 P295Q probably damaging Het
Kdm2b T C 5: 122,880,516 N954D probably benign Het
Klf15 C T 6: 90,466,796 H118Y probably damaging Het
Lrit2 G T 14: 37,069,077 A238S probably damaging Het
Man2c1 A C 9: 57,135,499 M218L probably benign Het
Map3k1 T A 13: 111,755,604 H1039L probably damaging Het
Map3k9 A G 12: 81,722,362 S971P probably benign Het
Map4k3 C T 17: 80,664,017 V74I probably damaging Het
Mars A T 10: 127,300,499 S486T possibly damaging Het
Mettl13 A T 1: 162,544,318 S327R possibly damaging Het
Mkks G A 2: 136,881,003 T78M possibly damaging Het
Myh1 G T 11: 67,221,639 A1811S probably damaging Het
Myh13 A G 11: 67,350,287 H830R possibly damaging Het
Nek4 A G 14: 30,970,548 D443G possibly damaging Het
Nf1 T C 11: 79,547,692 L137P probably damaging Het
Nipsnap3b T C 4: 53,012,049 probably null Het
Nos1ap G T 1: 170,327,625 P220T unknown Het
Nrxn3 T A 12: 90,331,809 I368N probably benign Het
Nup133 T A 8: 123,922,417 Q562L probably benign Het
Nup214 T A 2: 31,990,254 L342Q probably damaging Het
Nxn A G 11: 76,272,406 S264P probably damaging Het
Olfr739 G T 14: 50,424,680 D54Y probably damaging Het
Otud4 T C 8: 79,669,298 S567P probably benign Het
Patl2 A C 2: 122,125,273 S261A probably damaging Het
Pcdh15 C T 10: 74,291,033 P315S probably damaging Het
Pcm1 T A 8: 41,283,579 H827Q probably damaging Het
Pirb G A 7: 3,716,046 L615F probably damaging Het
Ppp1r12c T A 7: 4,489,769 H236L probably damaging Het
Prkd1 C T 12: 50,392,892 G384E probably benign Het
Rmnd1 C A 10: 4,427,278 E134* probably null Het
Rusc2 T A 4: 43,424,206 H1090Q possibly damaging Het
Sema5b A C 16: 35,651,321 Y428S possibly damaging Het
Slc2a8 T A 2: 32,975,998 I301L probably benign Het
Slc38a11 C T 2: 65,330,291 V320M probably damaging Het
Slc4a5 G T 6: 83,289,326 probably null Het
Slc7a6 T C 8: 106,193,533 I320T probably damaging Het
Slc8a3 A G 12: 81,199,768 I837T probably benign Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Tlr3 A T 8: 45,398,859 F334I possibly damaging Het
Unc13b A G 4: 43,217,290 I530V probably benign Het
Vmn2r68 T C 7: 85,237,514 D64G possibly damaging Het
Zfp157 T A 5: 138,456,256 Y239N probably damaging Het
Other mutations in Mst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mst1 APN 9 108081601 missense probably benign 0.03
IGL01380:Mst1 APN 9 108084588 missense probably damaging 1.00
IGL01420:Mst1 APN 9 108082828 missense probably damaging 0.99
IGL02931:Mst1 APN 9 108084642 splice site probably null
IGL03059:Mst1 APN 9 108084813 missense probably damaging 1.00
IGL03275:Mst1 APN 9 108084388 missense possibly damaging 0.70
R0319:Mst1 UTSW 9 108082513 missense probably benign 0.05
R0361:Mst1 UTSW 9 108084897 missense probably damaging 0.98
R0412:Mst1 UTSW 9 108083594 missense probably benign 0.06
R0569:Mst1 UTSW 9 108082301 missense probably damaging 0.98
R1432:Mst1 UTSW 9 108084204 missense probably benign 0.01
R1483:Mst1 UTSW 9 108081650 missense probably benign 0.03
R1859:Mst1 UTSW 9 108084346 missense probably benign 0.23
R2187:Mst1 UTSW 9 108084340 missense possibly damaging 0.63
R2393:Mst1 UTSW 9 108082952 critical splice donor site probably null
R3522:Mst1 UTSW 9 108081503 unclassified probably benign
R3916:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3917:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3945:Mst1 UTSW 9 108084853 missense probably damaging 1.00
R4006:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4007:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4737:Mst1 UTSW 9 108080521 missense probably benign 0.00
R4756:Mst1 UTSW 9 108083627 missense probably benign 0.28
R5047:Mst1 UTSW 9 108084309 missense probably benign 0.17
R5113:Mst1 UTSW 9 108082247 missense probably damaging 1.00
R5278:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5279:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5402:Mst1 UTSW 9 108084209 critical splice donor site probably null
R5677:Mst1 UTSW 9 108081286 missense probably damaging 0.98
R5712:Mst1 UTSW 9 108082908 missense probably damaging 1.00
R6717:Mst1 UTSW 9 108080575 splice site probably null
R7059:Mst1 UTSW 9 108084064 missense probably benign 0.44
R7131:Mst1 UTSW 9 108084931 missense probably null 0.07
R7139:Mst1 UTSW 9 108082828 missense probably damaging 0.99
R7219:Mst1 UTSW 9 108081286 missense probably damaging 0.99
R7501:Mst1 UTSW 9 108082549 missense probably damaging 1.00
R7878:Mst1 UTSW 9 108084613 missense probably benign
R8304:Mst1 UTSW 9 108081604 missense probably benign
R8715:Mst1 UTSW 9 108082043 missense possibly damaging 0.95
X0028:Mst1 UTSW 9 108082217 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGAATCTGGGTTGCCAG -3'
(R):5'- AACGGTCTGACCTGAAGTGTC -3'

Sequencing Primer
(F):5'- AGAATCTGGGTTGCCAGTTAAC -3'
(R):5'- TGACCTGAAGTGTCTGGCTCAC -3'
Posted On2020-09-02