Incidental Mutation 'R0021:Spaca6'
ID64769
Institutional Source Beutler Lab
Gene Symbol Spaca6
Ensembl Gene ENSMUSG00000080316
Gene Namesperm acrosome associated 6
SynonymsB230206P06Rik, 4930546H06Rik, Ncrna00085
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0021 (G1)
Quality Score126
Status Validated
Chromosome17
Chromosomal Location17827158-17843009 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 17838236 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 39 (Y39*)
Ref Sequence ENSEMBL: ENSMUSP00000154630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000139969] [ENSMUST00000150302] [ENSMUST00000172097] [ENSMUST00000226899] [ENSMUST00000228490]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000012759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137228
Predicted Effect probably benign
Transcript: ENSMUST00000139969
SMART Domains Protein: ENSMUSP00000119658
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG 151 186 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150302
Predicted Effect probably null
Transcript: ENSMUST00000154301
AA Change: Y75*
SMART Domains Protein: ENSMUSP00000117377
Gene: ENSMUSG00000080316
AA Change: Y75*

DomainStartEndE-ValueType
Blast:IG 27 78 2e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155293
Predicted Effect probably null
Transcript: ENSMUST00000172097
AA Change: Y256*
SMART Domains Protein: ENSMUSP00000128732
Gene: ENSMUSG00000080316
AA Change: Y256*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IG 171 260 2.08e-1 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179350
Predicted Effect probably benign
Transcript: ENSMUST00000226899
Predicted Effect probably null
Transcript: ENSMUST00000228490
AA Change: Y39*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion that inactivates this gene exhibit impaired fertilization and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Spaca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Spaca6 APN 17 17831167 missense probably benign 0.41
IGL02630:Spaca6 APN 17 17831089 missense probably damaging 1.00
IGL03010:Spaca6 APN 17 17838405 missense probably benign 0.01
IGL03352:Spaca6 APN 17 17838139 missense probably damaging 1.00
R0964:Spaca6 UTSW 17 17838391 missense possibly damaging 0.46
R1941:Spaca6 UTSW 17 17838402 missense probably benign 0.05
R1941:Spaca6 UTSW 17 17838430 missense probably damaging 0.99
R2197:Spaca6 UTSW 17 17836154 critical splice donor site probably null
R2235:Spaca6 UTSW 17 17838245 critical splice donor site probably null
R4602:Spaca6 UTSW 17 17831125 missense probably damaging 0.99
R4645:Spaca6 UTSW 17 17836045 intron probably benign
R4672:Spaca6 UTSW 17 17836743 nonsense probably null
R5044:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R5212:Spaca6 UTSW 17 17838394 missense probably benign 0.01
R5222:Spaca6 UTSW 17 17838105 missense probably benign 0.02
R5528:Spaca6 UTSW 17 17831082 missense probably benign
R5854:Spaca6 UTSW 17 17831247 nonsense probably null
R6029:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R7041:Spaca6 UTSW 17 17836096 missense probably benign 0.14
R7268:Spaca6 UTSW 17 17832107 missense probably benign 0.09
Z1177:Spaca6 UTSW 17 17831052 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTAGTGCAGCCAGTAGAGCCAGAG -3'
(R):5'- GTCCGATTCATCACTTCCCGGAAC -3'

Sequencing Primer
(F):5'- CGGTGCATTTAAGCACTTCAG -3'
(R):5'- TCACTTCCCGGAACGTGAC -3'
Posted On2013-08-06