Incidental Mutation 'R8398:Spon2'
ID647707
Institutional Source Beutler Lab
Gene Symbol Spon2
Ensembl Gene ENSMUSG00000037379
Gene Namespondin 2, extracellular matrix protein
SynonymsM-spondin, 2310045I24Rik, Mindin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R8398 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location33198184-33218455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33216810 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 76 (H76Q)
Ref Sequence ENSEMBL: ENSMUSP00000042701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046186] [ENSMUST00000201475]
Predicted Effect probably damaging
Transcript: ENSMUST00000046186
AA Change: H76Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042701
Gene: ENSMUSG00000037379
AA Change: H76Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Spond_N 40 234 2.3e-79 PFAM
TSP1 279 330 4.48e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201475
AA Change: H76Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144416
Gene: ENSMUSG00000037379
AA Change: H76Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Spond_N 40 179 2.4e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have an essentially normal phenotype. There is some alteration in succeptibility to bacterial infection however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,678 D6086G probably damaging Het
Amh T C 10: 80,805,560 S105P probably benign Het
Arap2 A T 5: 62,748,909 Y256N probably damaging Het
Asap3 G A 4: 136,234,393 M271I probably benign Het
Bbof1 T C 12: 84,428,414 L459P probably damaging Het
Ccl21a T C 4: 42,773,412 T109A probably benign Het
Cnot6 C T 11: 49,702,618 R12Q probably damaging Het
D5Ertd579e G A 5: 36,614,277 Q925* probably null Het
Dbh G A 2: 27,174,898 V374M probably damaging Het
Dvl2 T A 11: 70,008,302 L462Q probably damaging Het
Fchsd1 G A 18: 37,966,524 R206C probably damaging Het
Gjd4 C T 18: 9,280,326 V251M possibly damaging Het
Glud1 A G 14: 34,311,271 D125G probably benign Het
Gm10428 T C 11: 62,753,347 I83T unknown Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm3045 A G 13: 56,429,467 T143A possibly damaging Het
Heatr6 A C 11: 83,781,338 E1057D probably benign Het
Hoxa9 T C 6: 52,224,423 T213A probably damaging Het
Hsd3b5 T A 3: 98,619,404 D242V possibly damaging Het
Lama5 A G 2: 180,197,034 probably null Het
Lrp1b C T 2: 40,701,807 C3827Y Het
Mast2 A T 4: 116,308,749 S1261T probably damaging Het
Mex3b T A 7: 82,869,634 F386I probably benign Het
Mta1 T A 12: 113,131,622 M465K possibly damaging Het
Mtmr12 T A 15: 12,265,609 F470L probably damaging Het
Myot A G 18: 44,354,816 N400S probably benign Het
Ndnf T C 6: 65,704,378 V547A probably damaging Het
Noc3l A T 19: 38,795,110 D607E probably benign Het
Olfr1137 A G 2: 87,711,831 V25A probably benign Het
Pcdha11 G A 18: 37,013,063 G736R possibly damaging Het
Pcgf3 A G 5: 108,499,643 N205S probably damaging Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Psg27 T C 7: 18,561,912 T203A probably benign Het
Ptch1 T C 13: 63,525,125 T889A probably benign Het
Sars C T 3: 108,428,173 probably null Het
Scrn2 G T 11: 97,030,904 V67L probably benign Het
Slc1a4 T C 11: 20,307,982 D380G probably damaging Het
Slc9a1 A T 4: 133,419,503 Q516L probably benign Het
Smc4 T C 3: 69,025,851 Y627H probably damaging Het
Sppl2b CTGTCACA C 10: 80,866,068 probably null Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Sugp1 A G 8: 70,071,133 Y550C probably damaging Het
Sun1 A G 5: 139,236,653 D558G probably damaging Het
Syne1 T C 10: 5,124,923 E1134G probably damaging Het
Thbd C T 2: 148,406,680 V423I probably benign Het
V1rd19 C A 7: 24,003,949 S280* probably null Het
Zfp947 A T 17: 22,146,121 C191S probably benign Het
Other mutations in Spon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Spon2 APN 5 33216703 missense probably damaging 1.00
IGL01781:Spon2 APN 5 33215560 missense probably benign 0.09
IGL02533:Spon2 APN 5 33214598 missense probably damaging 1.00
R1557:Spon2 UTSW 5 33216764 missense probably damaging 1.00
R1711:Spon2 UTSW 5 33216385 missense probably damaging 1.00
R4728:Spon2 UTSW 5 33217338 missense probably benign 0.01
R4793:Spon2 UTSW 5 33214560 missense probably damaging 0.99
R4961:Spon2 UTSW 5 33214552 nonsense probably null
R6930:Spon2 UTSW 5 33216427 missense probably benign
R7067:Spon2 UTSW 5 33214614 missense probably damaging 1.00
R7643:Spon2 UTSW 5 33217456 missense probably benign 0.00
R7727:Spon2 UTSW 5 33215675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACTTACCAGCGAGTGCC -3'
(R):5'- GTGGATGTGGCTCCTTACCATTC -3'

Sequencing Primer
(F):5'- GTGCACCTCTAACTCTGTGGAAG -3'
(R):5'- CTTACCATTCAGTCAGGGAGCTG -3'
Posted On2020-09-02