Incidental Mutation 'R8398:D5Ertd579e'
ID647708
Institutional Source Beutler Lab
Gene Symbol D5Ertd579e
Ensembl Gene ENSMUSG00000029190
Gene NameDNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R8398 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36600485-36696024 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 36614277 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 925 (Q925*)
Ref Sequence ENSEMBL: ENSMUSP00000031091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031091]
Predicted Effect probably null
Transcript: ENSMUST00000031091
AA Change: Q925*
SMART Domains Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: Q925*

DomainStartEndE-ValueType
Pfam:DUF4603 23 1303 N/A PFAM
low complexity region 1365 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132383
SMART Domains Protein: ENSMUSP00000116548
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 1 1181 N/A PFAM
low complexity region 1243 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,678 D6086G probably damaging Het
Amh T C 10: 80,805,560 S105P probably benign Het
Arap2 A T 5: 62,748,909 Y256N probably damaging Het
Asap3 G A 4: 136,234,393 M271I probably benign Het
Bbof1 T C 12: 84,428,414 L459P probably damaging Het
Ccl21a T C 4: 42,773,412 T109A probably benign Het
Cnot6 C T 11: 49,702,618 R12Q probably damaging Het
Dbh G A 2: 27,174,898 V374M probably damaging Het
Dvl2 T A 11: 70,008,302 L462Q probably damaging Het
Fchsd1 G A 18: 37,966,524 R206C probably damaging Het
Gjd4 C T 18: 9,280,326 V251M possibly damaging Het
Glud1 A G 14: 34,311,271 D125G probably benign Het
Gm10428 T C 11: 62,753,347 I83T unknown Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm3045 A G 13: 56,429,467 T143A possibly damaging Het
Heatr6 A C 11: 83,781,338 E1057D probably benign Het
Hoxa9 T C 6: 52,224,423 T213A probably damaging Het
Hsd3b5 T A 3: 98,619,404 D242V possibly damaging Het
Lama5 A G 2: 180,197,034 probably null Het
Lrp1b C T 2: 40,701,807 C3827Y Het
Mast2 A T 4: 116,308,749 S1261T probably damaging Het
Mex3b T A 7: 82,869,634 F386I probably benign Het
Mta1 T A 12: 113,131,622 M465K possibly damaging Het
Mtmr12 T A 15: 12,265,609 F470L probably damaging Het
Myot A G 18: 44,354,816 N400S probably benign Het
Ndnf T C 6: 65,704,378 V547A probably damaging Het
Noc3l A T 19: 38,795,110 D607E probably benign Het
Olfr1137 A G 2: 87,711,831 V25A probably benign Het
Pcdha11 G A 18: 37,013,063 G736R possibly damaging Het
Pcgf3 A G 5: 108,499,643 N205S probably damaging Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Psg27 T C 7: 18,561,912 T203A probably benign Het
Ptch1 T C 13: 63,525,125 T889A probably benign Het
Sars C T 3: 108,428,173 probably null Het
Scrn2 G T 11: 97,030,904 V67L probably benign Het
Slc1a4 T C 11: 20,307,982 D380G probably damaging Het
Slc9a1 A T 4: 133,419,503 Q516L probably benign Het
Smc4 T C 3: 69,025,851 Y627H probably damaging Het
Spon2 G T 5: 33,216,810 H76Q probably damaging Het
Sppl2b CTGTCACA C 10: 80,866,068 probably null Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Sugp1 A G 8: 70,071,133 Y550C probably damaging Het
Sun1 A G 5: 139,236,653 D558G probably damaging Het
Syne1 T C 10: 5,124,923 E1134G probably damaging Het
Thbd C T 2: 148,406,680 V423I probably benign Het
V1rd19 C A 7: 24,003,949 S280* probably null Het
Zfp947 A T 17: 22,146,121 C191S probably benign Het
Other mutations in D5Ertd579e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:D5Ertd579e APN 5 36618754 missense probably damaging 0.99
IGL01925:D5Ertd579e APN 5 36614284 missense possibly damaging 0.67
IGL01933:D5Ertd579e APN 5 36615756 missense probably benign
IGL02164:D5Ertd579e APN 5 36614959 missense probably damaging 1.00
IGL02399:D5Ertd579e APN 5 36616185 missense probably damaging 1.00
IGL02896:D5Ertd579e APN 5 36613982 missense possibly damaging 0.70
IGL03141:D5Ertd579e APN 5 36613277 missense possibly damaging 0.94
IGL03235:D5Ertd579e APN 5 36618828 splice site probably benign
R0201:D5Ertd579e UTSW 5 36616465 missense probably damaging 1.00
R0377:D5Ertd579e UTSW 5 36604567 missense probably benign 0.12
R0830:D5Ertd579e UTSW 5 36613757 missense probably damaging 1.00
R0926:D5Ertd579e UTSW 5 36672866 missense probably damaging 1.00
R1350:D5Ertd579e UTSW 5 36613737 missense probably damaging 1.00
R1448:D5Ertd579e UTSW 5 36602739 missense probably benign
R1672:D5Ertd579e UTSW 5 36613277 missense possibly damaging 0.50
R1676:D5Ertd579e UTSW 5 36616109 missense probably benign 0.01
R1693:D5Ertd579e UTSW 5 36614097 missense probably damaging 0.98
R1698:D5Ertd579e UTSW 5 36604530 missense probably benign
R1868:D5Ertd579e UTSW 5 36616427 missense probably damaging 0.99
R1909:D5Ertd579e UTSW 5 36614058 missense probably benign 0.21
R2034:D5Ertd579e UTSW 5 36613538 nonsense probably null
R2080:D5Ertd579e UTSW 5 36616206 missense probably benign 0.01
R2105:D5Ertd579e UTSW 5 36613449 missense probably benign 0.12
R2197:D5Ertd579e UTSW 5 36614793 missense possibly damaging 0.69
R4212:D5Ertd579e UTSW 5 36614479 missense probably damaging 0.99
R4452:D5Ertd579e UTSW 5 36616470 missense probably damaging 1.00
R4626:D5Ertd579e UTSW 5 36614559 missense possibly damaging 0.92
R4804:D5Ertd579e UTSW 5 36629652 splice site probably null
R4898:D5Ertd579e UTSW 5 36614941 missense probably damaging 0.99
R4917:D5Ertd579e UTSW 5 36615816 missense probably damaging 1.00
R4960:D5Ertd579e UTSW 5 36616227 nonsense probably null
R4973:D5Ertd579e UTSW 5 36672905 missense probably benign
R5092:D5Ertd579e UTSW 5 36602703 missense probably benign 0.18
R5474:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5475:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5476:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5477:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5801:D5Ertd579e UTSW 5 36604569 missense probably damaging 1.00
R6019:D5Ertd579e UTSW 5 36629692 missense possibly damaging 0.90
R6184:D5Ertd579e UTSW 5 36629783 missense probably damaging 0.99
R6213:D5Ertd579e UTSW 5 36602634 missense probably damaging 1.00
R6244:D5Ertd579e UTSW 5 36615276 missense probably damaging 0.98
R6276:D5Ertd579e UTSW 5 36604514 missense possibly damaging 0.66
R6285:D5Ertd579e UTSW 5 36615577 missense probably damaging 1.00
R6358:D5Ertd579e UTSW 5 36616236 splice site probably null
R6875:D5Ertd579e UTSW 5 36604657 splice site probably null
R6967:D5Ertd579e UTSW 5 36615756 missense probably benign
R7139:D5Ertd579e UTSW 5 36613976 missense probably damaging 1.00
R7329:D5Ertd579e UTSW 5 36616395 missense probably benign 0.21
R7464:D5Ertd579e UTSW 5 36613785 missense probably damaging 0.99
R7664:D5Ertd579e UTSW 5 36614617 missense probably benign 0.00
R7762:D5Ertd579e UTSW 5 36613381 missense
R7951:D5Ertd579e UTSW 5 36615173 missense probably benign
R8175:D5Ertd579e UTSW 5 36615470 missense probably damaging 1.00
R8217:D5Ertd579e UTSW 5 36614058 missense probably benign 0.00
R8233:D5Ertd579e UTSW 5 36615244 missense probably damaging 0.99
R8281:D5Ertd579e UTSW 5 36613320 missense
RF022:D5Ertd579e UTSW 5 36614662 missense probably damaging 1.00
X0019:D5Ertd579e UTSW 5 36613958 missense probably damaging 1.00
Z1176:D5Ertd579e UTSW 5 36615762 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGACACAAAGGGCTTCCAG -3'
(R):5'- CTGTTTGGATACTGAGGCGAAG -3'

Sequencing Primer
(F):5'- TGACCAGGAGCAAAGCTGTTTC -3'
(R):5'- GATGGAAGCCCTTCAAGAGCC -3'
Posted On2020-09-02