Mutagenetix > Incidental Mutation

Incidental Mutation 'R8398:Sppl2b'

647721

Institutional Source

Beutler Lab

Gene Symbol

Sppl2b

Ensembl Gene

ENSMUSG00000035206

Gene Name

signal peptide peptidase like 2B

Synonyms

3110056O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R8398 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

80855275-80868708 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CTGTCACA to C at 80866068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]

AlphaFold

Q3TD49

Predicted Effect

probably null
Transcript: ENSMUST00000035597

SMART Domains

Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
Pfam:PA	55	147	5.5e-14	PFAM
transmembrane domain	167	189	N/A	INTRINSIC
PSN	210	485	2.16e-113	SMART
low complexity region	520	531	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000218789

Predicted Effect

probably benign
Transcript: ENSMUST00000219614

Predicted Effect

probably null
Transcript: ENSMUST00000219951

Predicted Effect

probably null
Transcript: ENSMUST00000220091

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	C	13: 81,182,678	D6086G	probably damaging	Het
Amh	T	C	10: 80,805,560	S105P	probably benign	Het
Arap2	A	T	5: 62,748,909	Y256N	probably damaging	Het
Asap3	G	A	4: 136,234,393	M271I	probably benign	Het
Bbof1	T	C	12: 84,428,414	L459P	probably damaging	Het
Ccl21a	T	C	4: 42,773,412	T109A	probably benign	Het
Cnot6	C	T	11: 49,702,618	R12Q	probably damaging	Het
D5Ertd579e	G	A	5: 36,614,277	Q925*	probably null	Het
Dbh	G	A	2: 27,174,898	V374M	probably damaging	Het
Dvl2	T	A	11: 70,008,302	L462Q	probably damaging	Het
Fchsd1	G	A	18: 37,966,524	R206C	probably damaging	Het
Gjd4	C	T	18: 9,280,326	V251M	possibly damaging	Het
Glud1	A	G	14: 34,311,271	D125G	probably benign	Het
Gm10428	T	C	11: 62,753,347	I83T	unknown	Het
Gm10985	A	C	3: 53,845,253	Y19S	probably damaging	Het
Gm3045	A	G	13: 56,429,467	T143A	possibly damaging	Het
Heatr6	A	C	11: 83,781,338	E1057D	probably benign	Het
Hoxa9	T	C	6: 52,224,423	T213A	probably damaging	Het
Hsd3b5	T	A	3: 98,619,404	D242V	possibly damaging	Het
Lama5	A	G	2: 180,197,034		probably null	Het
Lrp1b	C	T	2: 40,701,807	C3827Y		Het
Mast2	A	T	4: 116,308,749	S1261T	probably damaging	Het
Mex3b	T	A	7: 82,869,634	F386I	probably benign	Het
Mta1	T	A	12: 113,131,622	M465K	possibly damaging	Het
Mtmr12	T	A	15: 12,265,609	F470L	probably damaging	Het
Myot	A	G	18: 44,354,816	N400S	probably benign	Het
Ndnf	T	C	6: 65,704,378	V547A	probably damaging	Het
Noc3l	A	T	19: 38,795,110	D607E	probably benign	Het
Olfr1137	A	G	2: 87,711,831	V25A	probably benign	Het
Pcdha11	G	A	18: 37,013,063	G736R	possibly damaging	Het
Pcgf3	A	G	5: 108,499,643	N205S	probably damaging	Het
Pkd1l3	C	T	8: 109,623,888	P455L	possibly damaging	Het
Psg27	T	C	7: 18,561,912	T203A	probably benign	Het
Ptch1	T	C	13: 63,525,125	T889A	probably benign	Het
Sars	C	T	3: 108,428,173		probably null	Het
Scrn2	G	T	11: 97,030,904	V67L	probably benign	Het
Slc1a4	T	C	11: 20,307,982	D380G	probably damaging	Het
Slc9a1	A	T	4: 133,419,503	Q516L	probably benign	Het
Smc4	T	C	3: 69,025,851	Y627H	probably damaging	Het
Spon2	G	T	5: 33,216,810	H76Q	probably damaging	Het
Sugp1	A	G	8: 70,071,133	Y550C	probably damaging	Het
Sun1	A	G	5: 139,236,653	D558G	probably damaging	Het
Syne1	T	C	10: 5,124,923	E1134G	probably damaging	Het
Thbd	C	T	2: 148,406,680	V423I	probably benign	Het
V1rd19	C	A	7: 24,003,949	S280*	probably null	Het
Zfp947	A	T	17: 22,146,121	C191S	probably benign	Het

Other mutations in Sppl2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Sppl2b	APN	10	80864094	missense	probably damaging	1.00
IGL01835:Sppl2b	APN	10	80865341	missense	probably damaging	0.99
IGL01836:Sppl2b	APN	10	80861386	missense	probably benign	0.00
IGL01964:Sppl2b	APN	10	80865386	critical splice donor site	probably null
IGL02376:Sppl2b	APN	10	80867598	nonsense	probably null
R1641:Sppl2b	UTSW	10	80865131	missense	probably damaging	0.96
R2228:Sppl2b	UTSW	10	80865617	missense	probably damaging	1.00
R3104:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R3106:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R4350:Sppl2b	UTSW	10	80862726	missense	probably benign	0.12
R5146:Sppl2b	UTSW	10	80867640	makesense	probably null
R5698:Sppl2b	UTSW	10	80866045	splice site	probably null
R6969:Sppl2b	UTSW	10	80865125	missense	probably damaging	1.00
R7649:Sppl2b	UTSW	10	80867419	missense	probably benign	0.02
R8212:Sppl2b	UTSW	10	80865359	missense	probably damaging	1.00
R8263:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8265:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8367:Sppl2b	UTSW	10	80863191	missense	probably benign	0.02
R8398:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8400:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8480:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8481:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8505:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8817:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8818:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8832:Sppl2b	UTSW	10	80866069	frame shift	probably null
R9175:Sppl2b	UTSW	10	80862973	missense	probably benign
R9624:Sppl2b	UTSW	10	80863539	missense	probably benign	0.03
Z1176:Sppl2b	UTSW	10	80867425	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- ATGTGCATGCCCATTGTCACC -3'
(R):5'- TGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'

Posted On

2020-09-02