Incidental Mutation 'R8398:Sppl2b'
ID647722
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R8398 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80866069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,678 D6086G probably damaging Het
Amh T C 10: 80,805,560 S105P probably benign Het
Arap2 A T 5: 62,748,909 Y256N probably damaging Het
Asap3 G A 4: 136,234,393 M271I probably benign Het
Bbof1 T C 12: 84,428,414 L459P probably damaging Het
Ccl21a T C 4: 42,773,412 T109A probably benign Het
Cnot6 C T 11: 49,702,618 R12Q probably damaging Het
D5Ertd579e G A 5: 36,614,277 Q925* probably null Het
Dbh G A 2: 27,174,898 V374M probably damaging Het
Dvl2 T A 11: 70,008,302 L462Q probably damaging Het
Fchsd1 G A 18: 37,966,524 R206C probably damaging Het
Gjd4 C T 18: 9,280,326 V251M possibly damaging Het
Glud1 A G 14: 34,311,271 D125G probably benign Het
Gm10428 T C 11: 62,753,347 I83T unknown Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm3045 A G 13: 56,429,467 T143A possibly damaging Het
Heatr6 A C 11: 83,781,338 E1057D probably benign Het
Hoxa9 T C 6: 52,224,423 T213A probably damaging Het
Hsd3b5 T A 3: 98,619,404 D242V possibly damaging Het
Lama5 A G 2: 180,197,034 probably null Het
Lrp1b C T 2: 40,701,807 C3827Y Het
Mast2 A T 4: 116,308,749 S1261T probably damaging Het
Mex3b T A 7: 82,869,634 F386I probably benign Het
Mta1 T A 12: 113,131,622 M465K possibly damaging Het
Mtmr12 T A 15: 12,265,609 F470L probably damaging Het
Myot A G 18: 44,354,816 N400S probably benign Het
Ndnf T C 6: 65,704,378 V547A probably damaging Het
Noc3l A T 19: 38,795,110 D607E probably benign Het
Olfr1137 A G 2: 87,711,831 V25A probably benign Het
Pcdha11 G A 18: 37,013,063 G736R possibly damaging Het
Pcgf3 A G 5: 108,499,643 N205S probably damaging Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Psg27 T C 7: 18,561,912 T203A probably benign Het
Ptch1 T C 13: 63,525,125 T889A probably benign Het
Sars C T 3: 108,428,173 probably null Het
Scrn2 G T 11: 97,030,904 V67L probably benign Het
Slc1a4 T C 11: 20,307,982 D380G probably damaging Het
Slc9a1 A T 4: 133,419,503 Q516L probably benign Het
Smc4 T C 3: 69,025,851 Y627H probably damaging Het
Spon2 G T 5: 33,216,810 H76Q probably damaging Het
Sugp1 A G 8: 70,071,133 Y550C probably damaging Het
Sun1 A G 5: 139,236,653 D558G probably damaging Het
Syne1 T C 10: 5,124,923 E1134G probably damaging Het
Thbd C T 2: 148,406,680 V423I probably benign Het
V1rd19 C A 7: 24,003,949 S280* probably null Het
Zfp947 A T 17: 22,146,121 C191S probably benign Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATGTGCATGCCCATTGTCACC -3'
(R):5'- TGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On2020-09-02