Incidental Mutation 'R8398:Mtmr12'
ID647735
Institutional Source Beutler Lab
Gene Symbol Mtmr12
Ensembl Gene ENSMUSG00000039458
Gene Namemyotubularin related protein 12
SynonymsPip3ap, C730015A02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8398 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location12205028-12274496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12265609 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 470 (F470L)
Ref Sequence ENSEMBL: ENSMUSP00000041227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038172] [ENSMUST00000071993] [ENSMUST00000174160] [ENSMUST00000174418]
Predicted Effect probably damaging
Transcript: ENSMUST00000038172
AA Change: F470L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041227
Gene: ENSMUSG00000039458
AA Change: F470L

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 7.6e-55 PFAM
Pfam:3-PAP 559 687 3.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071993
AA Change: F160L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071883
Gene: ENSMUSG00000039458
AA Change: F160L

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Myotub-related 17 193 7.8e-53 PFAM
Pfam:3-PAP 249 380 8.8e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174160
AA Change: F470L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134293
Gene: ENSMUSG00000039458
AA Change: F470L

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 3.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174418
SMART Domains Protein: ENSMUSP00000133285
Gene: ENSMUSG00000039458

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositide 3-kinase-derived membrane-anchored phosphatidylinositides, such as phosphatidylinositol 3-phosphate (PtdIns(3)P), regulate diverse cellular processes. The protein encoded by this gene functions as an adaptor subunit in a complex with an active PtdIns(3)P 3-phosphatase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,678 D6086G probably damaging Het
Amh T C 10: 80,805,560 S105P probably benign Het
Arap2 A T 5: 62,748,909 Y256N probably damaging Het
Asap3 G A 4: 136,234,393 M271I probably benign Het
Bbof1 T C 12: 84,428,414 L459P probably damaging Het
Ccl21a T C 4: 42,773,412 T109A probably benign Het
Cnot6 C T 11: 49,702,618 R12Q probably damaging Het
D5Ertd579e G A 5: 36,614,277 Q925* probably null Het
Dbh G A 2: 27,174,898 V374M probably damaging Het
Dvl2 T A 11: 70,008,302 L462Q probably damaging Het
Fchsd1 G A 18: 37,966,524 R206C probably damaging Het
Gjd4 C T 18: 9,280,326 V251M possibly damaging Het
Glud1 A G 14: 34,311,271 D125G probably benign Het
Gm10428 T C 11: 62,753,347 I83T unknown Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm3045 A G 13: 56,429,467 T143A possibly damaging Het
Heatr6 A C 11: 83,781,338 E1057D probably benign Het
Hoxa9 T C 6: 52,224,423 T213A probably damaging Het
Hsd3b5 T A 3: 98,619,404 D242V possibly damaging Het
Lama5 A G 2: 180,197,034 probably null Het
Lrp1b C T 2: 40,701,807 C3827Y Het
Mast2 A T 4: 116,308,749 S1261T probably damaging Het
Mex3b T A 7: 82,869,634 F386I probably benign Het
Mta1 T A 12: 113,131,622 M465K possibly damaging Het
Myot A G 18: 44,354,816 N400S probably benign Het
Ndnf T C 6: 65,704,378 V547A probably damaging Het
Noc3l A T 19: 38,795,110 D607E probably benign Het
Olfr1137 A G 2: 87,711,831 V25A probably benign Het
Pcdha11 G A 18: 37,013,063 G736R possibly damaging Het
Pcgf3 A G 5: 108,499,643 N205S probably damaging Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Psg27 T C 7: 18,561,912 T203A probably benign Het
Ptch1 T C 13: 63,525,125 T889A probably benign Het
Sars C T 3: 108,428,173 probably null Het
Scrn2 G T 11: 97,030,904 V67L probably benign Het
Slc1a4 T C 11: 20,307,982 D380G probably damaging Het
Slc9a1 A T 4: 133,419,503 Q516L probably benign Het
Smc4 T C 3: 69,025,851 Y627H probably damaging Het
Spon2 G T 5: 33,216,810 H76Q probably damaging Het
Sppl2b CTGTCACA C 10: 80,866,068 probably null Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Sugp1 A G 8: 70,071,133 Y550C probably damaging Het
Sun1 A G 5: 139,236,653 D558G probably damaging Het
Syne1 T C 10: 5,124,923 E1134G probably damaging Het
Thbd C T 2: 148,406,680 V423I probably benign Het
V1rd19 C A 7: 24,003,949 S280* probably null Het
Zfp947 A T 17: 22,146,121 C191S probably benign Het
Other mutations in Mtmr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Mtmr12 APN 15 12269959 missense probably damaging 1.00
IGL02158:Mtmr12 APN 15 12237930 missense probably damaging 1.00
pius UTSW 15 12245011 missense probably damaging 1.00
R0281:Mtmr12 UTSW 15 12257706 nonsense probably null
R1739:Mtmr12 UTSW 15 12245019 missense probably benign 0.06
R1876:Mtmr12 UTSW 15 12257630 missense probably damaging 1.00
R2284:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
R4301:Mtmr12 UTSW 15 12236020 missense possibly damaging 0.95
R4424:Mtmr12 UTSW 15 12230314 missense probably damaging 0.98
R4617:Mtmr12 UTSW 15 12270046 missense probably damaging 1.00
R5418:Mtmr12 UTSW 15 12269959 missense probably damaging 1.00
R6316:Mtmr12 UTSW 15 12236113 missense probably null 0.31
R6857:Mtmr12 UTSW 15 12263832 missense probably damaging 1.00
R7068:Mtmr12 UTSW 15 12257670 missense probably null 0.08
R7511:Mtmr12 UTSW 15 12265595 missense possibly damaging 0.94
R7515:Mtmr12 UTSW 15 12269951 missense probably damaging 1.00
R7607:Mtmr12 UTSW 15 12257708 nonsense probably null
R7709:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
R8217:Mtmr12 UTSW 15 12259640 missense possibly damaging 0.89
R8257:Mtmr12 UTSW 15 12259598 missense possibly damaging 0.89
R8778:Mtmr12 UTSW 15 12269920 missense probably benign 0.00
RF013:Mtmr12 UTSW 15 12261898 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCTGAGAATGTTCATCACTTGG -3'
(R):5'- GCAGCTTCTTTGACACACAG -3'

Sequencing Primer
(F):5'- CTGAGAATGTTCATCACTTGGAGTAG -3'
(R):5'- TCTTTGACACACAGAGACCAGGTTG -3'
Posted On2020-09-02