Incidental Mutation 'R8399:Raph1'
ID647743
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene NameRas association (RalGDS/AF-6) and pleckstrin homology domains 1
SynonymsC730009O10Rik, Lpd, 9430025M21Rik, lamellipodin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location60482292-60567104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60489318 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 928 (S928N)
Ref Sequence ENSEMBL: ENSMUSP00000121023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
Predicted Effect probably benign
Transcript: ENSMUST00000027168
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: S928N
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: S928N

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60525947 missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60502863 missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60489267 intron probably benign
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0227:Raph1 UTSW 1 60525977 missense probably benign 0.00
R0387:Raph1 UTSW 1 60510496 intron probably benign
R0607:Raph1 UTSW 1 60525869 missense probably damaging 1.00
R1740:Raph1 UTSW 1 60519024 nonsense probably null
R2274:Raph1 UTSW 1 60498500 missense probably damaging 1.00
R3108:Raph1 UTSW 1 60493386 missense probably benign 0.01
R3977:Raph1 UTSW 1 60498523 missense probably benign 0.39
R4260:Raph1 UTSW 1 60502965 missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60502869 missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60503001 unclassified probably benign
R4782:Raph1 UTSW 1 60489114 missense probably damaging 1.00
R5027:Raph1 UTSW 1 60496277 missense probably damaging 1.00
R5037:Raph1 UTSW 1 60496222 splice site probably null
R5106:Raph1 UTSW 1 60533300 missense probably damaging 1.00
R5506:Raph1 UTSW 1 60493498 intron probably benign
R5510:Raph1 UTSW 1 60522946 unclassified probably benign
R5587:Raph1 UTSW 1 60498473 missense probably damaging 1.00
R5591:Raph1 UTSW 1 60501746 unclassified probably benign
R5619:Raph1 UTSW 1 60490255 intron probably benign
R5776:Raph1 UTSW 1 60490156 intron probably benign
R5802:Raph1 UTSW 1 60488673 missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60525720 missense probably damaging 0.97
R7122:Raph1 UTSW 1 60525977 missense probably benign 0.10
R7219:Raph1 UTSW 1 60502873 missense unknown
R7251:Raph1 UTSW 1 60489868 missense unknown
R7254:Raph1 UTSW 1 60499608 missense unknown
R7732:Raph1 UTSW 1 60533288 missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60525989 missense probably benign 0.00
R7986:Raph1 UTSW 1 60496286 missense
R8167:Raph1 UTSW 1 60490111 missense unknown
R8168:Raph1 UTSW 1 60499620 missense unknown
RF018:Raph1 UTSW 1 60489267 intron probably benign
RF022:Raph1 UTSW 1 60489267 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTTAATGCTGGAGTTGCGC -3'
(R):5'- TCCGTTGTGAAGCAGATAGC -3'

Sequencing Primer
(F):5'- CTGGAGTTGCGCTGCGG -3'
(R):5'- GCAGATAGCCAGTCAGTTTCC -3'
Posted On2020-09-02