Mutagenetix > Incidental Mutation

Incidental Mutation 'R8399:Raph1'

647743

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R8399 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 60489318 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 928 (S928N)

Ref Sequence

ENSEMBL: ENSMUSP00000121023 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]

AlphaFold

F2Z3U3

Predicted Effect

probably benign
Transcript: ENSMUST00000027168

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090293

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: S928N

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: S928N

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182085

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,489,170	V3384D	possibly damaging	Het
Apba3	C	A	10: 81,268,998	T35N	probably benign	Het
Bcl6	T	C	16: 23,972,948	M219V	probably benign	Het
Bco2	T	A	9: 50,541,118	T217S	probably benign	Het
C1s1	C	T	6: 124,535,293	V277I	probably benign	Het
Ccdc162	T	A	10: 41,539,521	R2149W	probably damaging	Het
Cers6	T	C	2: 68,861,771	F46L	probably benign	Het
Chpf	T	C	1: 75,476,220	I359V	probably benign	Het
Chrnb4	A	C	9: 55,043,823	L52R	probably benign	Het
Cox6a1	T	C	5: 115,345,899	T95A	probably damaging	Het
Def8	T	A	8: 123,455,499	Y197*	probably null	Het
Dmbt1	C	G	7: 131,082,587	D778E	unknown	Het
Dnaaf3	C	T	7: 4,523,937		probably null	Het
Dnm1l	T	A	16: 16,321,672	H484L	probably damaging	Het
Eml1	G	A	12: 108,538,131	S783N	possibly damaging	Het
Frmd4a	T	C	2: 4,572,433	S367P	probably damaging	Het
Hck	A	C	2: 153,138,317	K355N	probably damaging	Het
Hexim2	G	T	11: 103,138,503	R127L	probably damaging	Het
Hivep2	T	C	10: 14,132,434	L1592P	possibly damaging	Het
Htr1d	G	A	4: 136,443,375	G305E	probably damaging	Het
Ifi207	G	A	1: 173,730,278	S298L	unknown	Het
Ighv1-11	A	G	12: 114,612,427	V56A	possibly damaging	Het
Ighv7-1	G	A	12: 113,896,912	T12I	unknown	Het
Kctd14	T	C	7: 97,457,604	L22P	probably damaging	Het
Klra17	T	C	6: 129,874,937		probably benign	Het
Kndc1	C	T	7: 139,913,518	R467W	probably damaging	Het
Maf	T	A	8: 115,706,512	I118F	unknown	Het
Mppe1	T	C	18: 67,225,875	T341A	probably benign	Het
Mtmr2	T	A	9: 13,792,067	V186E	probably benign	Het
Nedd9	G	T	13: 41,318,474	Y176*	probably null	Het
Olfr1145	A	C	2: 87,810,224	M135L	probably damaging	Het
Olfr1238	T	C	2: 89,406,684	T132A	probably benign	Het
Omd	A	G	13: 49,589,869	I132V	possibly damaging	Het
Pcnx4	T	A	12: 72,574,211	M935K	probably benign	Het
Pecr	G	A	1: 72,267,465	T219I	probably benign	Het
Pkd1l3	C	T	8: 109,623,888	P455L	possibly damaging	Het
Plcg2	T	C	8: 117,596,362	Y719H	probably damaging	Het
Plk4	C	T	3: 40,808,830	R479*	probably null	Het
Pms1	T	A	1: 53,267,932		probably null	Het
Rtp4	G	T	16: 23,520,414		probably benign	Het
Skor1	C	T	9: 63,145,158	V510I	possibly damaging	Het
Smg1	T	C	7: 118,190,571	T699A	unknown	Het
Tcp11l1	T	C	2: 104,685,375	D381G	probably benign	Het
Tnik	T	A	3: 28,494,010	M56K	unknown	Het
Trappc9	G	A	15: 73,052,282	R204C	probably damaging	Het
Trmt10b	A	T	4: 45,305,870	M184L	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,749	I196N	probably damaging	Het
Vmn1r49	A	T	6: 90,072,707	C104*	probably null	Het
Vmn2r35	A	C	7: 7,816,898	S124R	probably benign	Het
Wdr62	T	C	7: 30,258,061	E547G	probably damaging	Het
Zfp68	A	T	5: 138,607,820	D80E	probably benign	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTTAATGCTGGAGTTGCGC -3'
(R):5'- TCCGTTGTGAAGCAGATAGC -3'

Sequencing Primer
(F):5'- CTGGAGTTGCGCTGCGG -3'
(R):5'- GCAGATAGCCAGTCAGTTTCC -3'

Posted On

2020-09-02