Incidental Mutation 'R8399:Raph1'
ID 647743
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, lamellipodin, 9430025M21Rik, Lpd
MMRRC Submission 067762-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R8399 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 60521451-60606263 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60528477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 928 (S928N)
Ref Sequence ENSEMBL: ENSMUSP00000121023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
AlphaFold F2Z3U3
Predicted Effect probably benign
Transcript: ENSMUST00000027168
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: S928N
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: S928N

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,637,289 (GRCm39) V3384D possibly damaging Het
Apba3 C A 10: 81,104,832 (GRCm39) T35N probably benign Het
Bcl6 T C 16: 23,791,698 (GRCm39) M219V probably benign Het
Bco2 T A 9: 50,452,418 (GRCm39) T217S probably benign Het
C1s1 C T 6: 124,512,252 (GRCm39) V277I probably benign Het
Ccdc162 T A 10: 41,415,517 (GRCm39) R2149W probably damaging Het
Cers6 T C 2: 68,692,115 (GRCm39) F46L probably benign Het
Chpf T C 1: 75,452,864 (GRCm39) I359V probably benign Het
Chrnb4 A C 9: 54,951,107 (GRCm39) L52R probably benign Het
Cox6a1 T C 5: 115,483,958 (GRCm39) T95A probably damaging Het
Def8 T A 8: 124,182,238 (GRCm39) Y197* probably null Het
Dmbt1 C G 7: 130,684,317 (GRCm39) D778E unknown Het
Dnaaf3 C T 7: 4,526,936 (GRCm39) probably null Het
Dnm1l T A 16: 16,139,536 (GRCm39) H484L probably damaging Het
Eml1 G A 12: 108,504,390 (GRCm39) S783N possibly damaging Het
Frmd4a T C 2: 4,577,244 (GRCm39) S367P probably damaging Het
Hck A C 2: 152,980,237 (GRCm39) K355N probably damaging Het
Hexim2 G T 11: 103,029,329 (GRCm39) R127L probably damaging Het
Hivep2 T C 10: 14,008,178 (GRCm39) L1592P possibly damaging Het
Htr1d G A 4: 136,170,686 (GRCm39) G305E probably damaging Het
Ifi207 G A 1: 173,557,844 (GRCm39) S298L unknown Het
Ighv1-11 A G 12: 114,576,047 (GRCm39) V56A possibly damaging Het
Ighv7-1 G A 12: 113,860,532 (GRCm39) T12I unknown Het
Kctd14 T C 7: 97,106,811 (GRCm39) L22P probably damaging Het
Klra17 T C 6: 129,851,900 (GRCm39) probably benign Het
Kndc1 C T 7: 139,493,434 (GRCm39) R467W probably damaging Het
Maf T A 8: 116,433,251 (GRCm39) I118F unknown Het
Mppe1 T C 18: 67,358,946 (GRCm39) T341A probably benign Het
Mtmr2 T A 9: 13,703,363 (GRCm39) V186E probably benign Het
Nedd9 G T 13: 41,471,950 (GRCm39) Y176* probably null Het
Omd A G 13: 49,743,345 (GRCm39) I132V possibly damaging Het
Or12e10 A C 2: 87,640,568 (GRCm39) M135L probably damaging Het
Or4a39 T C 2: 89,237,028 (GRCm39) T132A probably benign Het
Pcnx4 T A 12: 72,620,985 (GRCm39) M935K probably benign Het
Pecr G A 1: 72,306,624 (GRCm39) T219I probably benign Het
Pkd1l3 C T 8: 110,350,520 (GRCm39) P455L possibly damaging Het
Plcg2 T C 8: 118,323,101 (GRCm39) Y719H probably damaging Het
Plk4 C T 3: 40,763,265 (GRCm39) R479* probably null Het
Pms1 T A 1: 53,307,091 (GRCm39) probably null Het
Rtp4 G T 16: 23,339,164 (GRCm39) probably benign Het
Skor1 C T 9: 63,052,440 (GRCm39) V510I possibly damaging Het
Smg1 T C 7: 117,789,794 (GRCm39) T699A unknown Het
Tcp11l1 T C 2: 104,515,720 (GRCm39) D381G probably benign Het
Tnik T A 3: 28,548,159 (GRCm39) M56K unknown Het
Trappc9 G A 15: 72,924,131 (GRCm39) R204C probably damaging Het
Trmt10b A T 4: 45,305,870 (GRCm39) M184L possibly damaging Het
Vmn1r224 T A 17: 20,640,011 (GRCm39) I196N probably damaging Het
Vmn1r49 A T 6: 90,049,689 (GRCm39) C104* probably null Het
Vmn2r35 A C 7: 7,819,897 (GRCm39) S124R probably benign Het
Wdr62 T C 7: 29,957,486 (GRCm39) E547G probably damaging Het
Zfp68 A T 5: 138,606,082 (GRCm39) D80E probably benign Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60,565,106 (GRCm39) missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60,542,022 (GRCm39) missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0227:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.00
R0387:Raph1 UTSW 1 60,549,655 (GRCm39) intron probably benign
R0607:Raph1 UTSW 1 60,565,028 (GRCm39) missense probably damaging 1.00
R1740:Raph1 UTSW 1 60,558,183 (GRCm39) nonsense probably null
R2274:Raph1 UTSW 1 60,537,659 (GRCm39) missense probably damaging 1.00
R3108:Raph1 UTSW 1 60,532,545 (GRCm39) missense probably benign 0.01
R3977:Raph1 UTSW 1 60,537,682 (GRCm39) missense probably benign 0.39
R4260:Raph1 UTSW 1 60,542,124 (GRCm39) missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60,542,028 (GRCm39) missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60,542,160 (GRCm39) unclassified probably benign
R4782:Raph1 UTSW 1 60,528,273 (GRCm39) missense probably damaging 1.00
R5027:Raph1 UTSW 1 60,535,436 (GRCm39) missense probably damaging 1.00
R5037:Raph1 UTSW 1 60,535,381 (GRCm39) splice site probably null
R5106:Raph1 UTSW 1 60,572,459 (GRCm39) missense probably damaging 1.00
R5506:Raph1 UTSW 1 60,532,657 (GRCm39) intron probably benign
R5510:Raph1 UTSW 1 60,562,105 (GRCm39) unclassified probably benign
R5587:Raph1 UTSW 1 60,537,632 (GRCm39) missense probably damaging 1.00
R5591:Raph1 UTSW 1 60,540,905 (GRCm39) unclassified probably benign
R5619:Raph1 UTSW 1 60,529,414 (GRCm39) intron probably benign
R5776:Raph1 UTSW 1 60,529,315 (GRCm39) intron probably benign
R5802:Raph1 UTSW 1 60,527,832 (GRCm39) missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60,564,879 (GRCm39) missense probably damaging 0.97
R7122:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.10
R7219:Raph1 UTSW 1 60,542,032 (GRCm39) missense unknown
R7251:Raph1 UTSW 1 60,529,027 (GRCm39) missense unknown
R7254:Raph1 UTSW 1 60,538,767 (GRCm39) missense unknown
R7732:Raph1 UTSW 1 60,572,447 (GRCm39) missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60,565,148 (GRCm39) missense probably benign 0.00
R7986:Raph1 UTSW 1 60,535,445 (GRCm39) missense
R8167:Raph1 UTSW 1 60,529,270 (GRCm39) missense unknown
R8168:Raph1 UTSW 1 60,538,779 (GRCm39) missense unknown
R9036:Raph1 UTSW 1 60,542,124 (GRCm39) missense unknown
R9146:Raph1 UTSW 1 60,558,137 (GRCm39) critical splice donor site probably null
R9338:Raph1 UTSW 1 60,529,300 (GRCm39) missense unknown
R9381:Raph1 UTSW 1 60,540,959 (GRCm39) missense unknown
R9383:Raph1 UTSW 1 60,564,829 (GRCm39) missense unknown
R9399:Raph1 UTSW 1 60,565,154 (GRCm39) missense probably benign
R9454:Raph1 UTSW 1 60,528,753 (GRCm39) missense unknown
R9561:Raph1 UTSW 1 60,564,887 (GRCm39) missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
RF022:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTTAATGCTGGAGTTGCGC -3'
(R):5'- TCCGTTGTGAAGCAGATAGC -3'

Sequencing Primer
(F):5'- CTGGAGTTGCGCTGCGG -3'
(R):5'- GCAGATAGCCAGTCAGTTTCC -3'
Posted On 2020-09-02