Incidental Mutation 'R8399:Chpf'
ID647745
Institutional Source Beutler Lab
Gene Symbol Chpf
Ensembl Gene ENSMUSG00000032997
Gene Namechondroitin polymerizing factor
Synonyms1700028N03Rik, D1Bwg1363e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location75474569-75479307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75476220 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 359 (I359V)
Ref Sequence ENSEMBL: ENSMUSP00000078199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037708] [ENSMUST00000050899] [ENSMUST00000079205] [ENSMUST00000094818] [ENSMUST00000113575] [ENSMUST00000113577] [ENSMUST00000124042] [ENSMUST00000138683] [ENSMUST00000148980] [ENSMUST00000187411]
Predicted Effect probably benign
Transcript: ENSMUST00000037708
SMART Domains Protein: ENSMUSP00000045598
Gene: ENSMUSG00000033007

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 464 5.3e-92 PFAM
low complexity region 507 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050899
SMART Domains Protein: ENSMUSP00000057865
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
Pfam:DUF4203 40 236 7.2e-51 PFAM
low complexity region 252 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079205
AA Change: I359V

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000078199
Gene: ENSMUSG00000032997
AA Change: I359V

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Pfam:CHGN 262 761 5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094818
AA Change: I197V

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092412
Gene: ENSMUSG00000032997
AA Change: I197V

DomainStartEndE-ValueType
Pfam:CHGN 100 599 3.3e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113575
SMART Domains Protein: ENSMUSP00000109205
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
Pfam:DUF4203 39 237 2.2e-59 PFAM
low complexity region 252 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113577
SMART Domains Protein: ENSMUSP00000109207
Gene: ENSMUSG00000033007

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 346 5.5e-94 PFAM
Pfam:ASC 344 446 1.4e-42 PFAM
low complexity region 488 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124042
SMART Domains Protein: ENSMUSP00000122057
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138683
SMART Domains Protein: ENSMUSP00000117253
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148980
SMART Domains Protein: ENSMUSP00000116977
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:DUF4203 119 150 6.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187411
SMART Domains Protein: ENSMUSP00000140795
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:DUF4203 101 142 6.9e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice are viable and no detectable mutant phenotype is reported. Mice homozygous for another knock-out allele exhibit slight reduction in femur and tibia length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Chpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0659:Chpf UTSW 1 75477723 missense probably damaging 0.98
R0789:Chpf UTSW 1 75475763 missense probably damaging 1.00
R1610:Chpf UTSW 1 75476648 missense probably damaging 1.00
R2384:Chpf UTSW 1 75475109 missense probably benign
R3937:Chpf UTSW 1 75477540 missense probably damaging 0.99
R4518:Chpf UTSW 1 75475045 missense probably damaging 1.00
R5336:Chpf UTSW 1 75475707 missense possibly damaging 0.96
R5859:Chpf UTSW 1 75475428 missense probably damaging 0.99
R6152:Chpf UTSW 1 75475643 missense possibly damaging 0.94
R7304:Chpf UTSW 1 75479054 missense possibly damaging 0.82
R7396:Chpf UTSW 1 75475283 missense probably benign 0.02
R7440:Chpf UTSW 1 75475601 missense probably damaging 1.00
R7840:Chpf UTSW 1 75476627 missense probably damaging 1.00
R7843:Chpf UTSW 1 75478287 unclassified probably benign
R7891:Chpf UTSW 1 75475295 missense probably benign 0.00
R7952:Chpf UTSW 1 75478942 missense probably benign 0.00
R7979:Chpf UTSW 1 75477260 nonsense probably null
R8159:Chpf UTSW 1 75478792 missense probably null 1.00
Z1176:Chpf UTSW 1 75475458 missense probably benign 0.08
Z1176:Chpf UTSW 1 75475470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGCTCCTCTAAGGCTGTCC -3'
(R):5'- TCTGTGAAGAAACTGCGCGC -3'

Sequencing Primer
(F):5'- TCAGCCACATCAGCCTGGTC -3'
(R):5'- CTCTGAGTATCACTGCCT -3'
Posted On2020-09-02