Incidental Mutation 'R8399:Frmd4a'
ID647747
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4572433 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 367 (S367P)
Ref Sequence ENSEMBL: ENSMUSP00000089079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000175669] [ENSMUST00000175944] [ENSMUST00000176828] [ENSMUST00000176864] [ENSMUST00000177457]
Predicted Effect probably damaging
Transcript: ENSMUST00000075767
AA Change: S356P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657
AA Change: S356P

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091497
AA Change: S367P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: S367P

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175669
AA Change: S386P
SMART Domains Protein: ENSMUSP00000135306
Gene: ENSMUSG00000026657
AA Change: S386P

DomainStartEndE-ValueType
B41 31 236 3.24e-40 SMART
FERM_C 240 341 7.69e-27 SMART
low complexity region 371 387 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175944
AA Change: S404P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135686
Gene: ENSMUSG00000026657
AA Change: S404P

DomainStartEndE-ValueType
B41 49 254 3.24e-40 SMART
FERM_C 258 359 7.69e-27 SMART
Pfam:DUF3338 388 525 6.5e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176828
AA Change: S62P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657
AA Change: S62P

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176864
AA Change: S51P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135057
Gene: ENSMUSG00000026657
AA Change: S51P

DomainStartEndE-ValueType
Pfam:DUF3338 35 150 2.6e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177457
AA Change: S371P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657
AA Change: S371P

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7607:Frmd4a UTSW 2 4591936 nonsense probably null
R7697:Frmd4a UTSW 2 4484081 missense probably damaging 1.00
R7750:Frmd4a UTSW 2 4601349 missense probably benign 0.14
R7795:Frmd4a UTSW 2 4590695 missense probably damaging 1.00
R7848:Frmd4a UTSW 2 4591917 intron probably benign
R7899:Frmd4a UTSW 2 4604089 missense probably damaging 1.00
R8024:Frmd4a UTSW 2 4603702 missense probably damaging 1.00
Z1176:Frmd4a UTSW 2 4498021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGGCTTACAAGTAGGCAAG -3'
(R):5'- CAATTTGTGCCTCACTGAAGTTAC -3'

Sequencing Primer
(F):5'- GGGCTTACAAGTAGGCAAGTATTTTC -3'
(R):5'- GTGCCTCACTGAAGTTACACACATC -3'
Posted On2020-09-02