Incidental Mutation 'R8399:Hck'
ID647752
Institutional Source Beutler Lab
Gene Symbol Hck
Ensembl Gene ENSMUSG00000003283
Gene Namehemopoietic cell kinase
SynonymsBmk, Hck-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location153108468-153151441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 153138317 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 355 (K355N)
Ref Sequence ENSEMBL: ENSMUSP00000003370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003370] [ENSMUST00000109799] [ENSMUST00000189688] [ENSMUST00000191431]
Predicted Effect probably damaging
Transcript: ENSMUST00000003370
AA Change: K355N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003370
Gene: ENSMUSG00000003283
AA Change: K355N

DomainStartEndE-ValueType
SH3 79 135 6e-20 SMART
SH2 140 230 2.51e-33 SMART
TyrKc 260 509 7.71e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109799
AA Change: K334N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105423
Gene: ENSMUSG00000003283
AA Change: K334N

DomainStartEndE-ValueType
SH3 58 114 6e-20 SMART
SH2 119 209 2.51e-33 SMART
TyrKc 239 488 7.71e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189688
AA Change: K334N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141030
Gene: ENSMUSG00000003283
AA Change: K334N

DomainStartEndE-ValueType
SH3 58 114 6e-20 SMART
SH2 119 209 2.51e-33 SMART
TyrKc 239 488 7.71e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191431
AA Change: K355N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139988
Gene: ENSMUSG00000003283
AA Change: K355N

DomainStartEndE-ValueType
SH3 79 135 6e-20 SMART
SH2 140 230 2.51e-33 SMART
TyrKc 260 509 7.71e-130 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may play a role in the innate immune response and the STAT5 signaling pathway. Alternative translation initiation site usage, including a non-AUG (CUG) codon, results in the production of two different isoforms, that have different subcellular localization. [provided by RefSeq, Feb 2010]
PHENOTYPE: Macrophages from mice homozygous for a targeted null mutation exhibit impaired phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Hck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Hck APN 2 153136733 missense probably benign 0.08
IGL00489:Hck APN 2 153151019 missense possibly damaging 0.80
IGL02682:Hck APN 2 153134134 missense probably damaging 0.98
PIT4466001:Hck UTSW 2 153124271 missense probably damaging 1.00
R0143:Hck UTSW 2 153134220 critical splice donor site probably null
R0441:Hck UTSW 2 153134132 missense probably benign 0.02
R1300:Hck UTSW 2 153134147 missense possibly damaging 0.94
R1366:Hck UTSW 2 153138295 missense probably damaging 1.00
R1445:Hck UTSW 2 153128272 missense probably benign 0.01
R1978:Hck UTSW 2 153129856 missense probably damaging 1.00
R4953:Hck UTSW 2 153134677 missense probably damaging 1.00
R5243:Hck UTSW 2 153144492 missense probably damaging 1.00
R5247:Hck UTSW 2 153134695 nonsense probably null
R5890:Hck UTSW 2 153129076 missense probably damaging 1.00
R7467:Hck UTSW 2 153129930 nonsense probably null
R7673:Hck UTSW 2 153129085 missense possibly damaging 0.95
R8328:Hck UTSW 2 153129067 missense probably damaging 1.00
X0025:Hck UTSW 2 153148968 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCGGAGACCAGTCTGAACAA -3'
(R):5'- ATGAGTTGGTTCATATGAAGAACAG -3'

Sequencing Primer
(F):5'- GAAAGTCATACCTGGCTTGCC -3'
(R):5'- GTTAGATTCCATAGGCCAGCTAG -3'
Posted On2020-09-02