Incidental Mutation 'R8399:Vmn1r49'
ID647759
Institutional Source Beutler Lab
Gene Symbol Vmn1r49
Ensembl Gene ENSMUSG00000095932
Gene Namevomeronasal 1, receptor 49
SynonymsVRi2, V1rb2, V1r5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location90071893-90078506 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 90072707 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 104 (C104*)
Ref Sequence ENSEMBL: ENSMUSP00000145107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071865] [ENSMUST00000203791] [ENSMUST00000226368]
Predicted Effect probably null
Transcript: ENSMUST00000071865
AA Change: C104*
SMART Domains Protein: ENSMUSP00000071762
Gene: ENSMUSG00000095932
AA Change: C104*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 5e-165 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203791
AA Change: C104*
SMART Domains Protein: ENSMUSP00000145107
Gene: ENSMUSG00000095932
AA Change: C104*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 5e-165 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226368
AA Change: C104*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a non-functional knock-in allele display abnormal patterns of axonal projections in the accessory olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Vmn1r49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Vmn1r49 APN 6 90072412 missense probably damaging 0.99
IGL03230:Vmn1r49 APN 6 90072668 missense probably damaging 1.00
IGL03308:Vmn1r49 APN 6 90072359 missense possibly damaging 0.67
R0517:Vmn1r49 UTSW 6 90072738 missense probably damaging 0.98
R0638:Vmn1r49 UTSW 6 90072666 missense possibly damaging 0.95
R1498:Vmn1r49 UTSW 6 90072316 missense probably damaging 1.00
R1649:Vmn1r49 UTSW 6 90072641 missense possibly damaging 0.66
R1668:Vmn1r49 UTSW 6 90072782 missense probably benign 0.07
R1816:Vmn1r49 UTSW 6 90072803 missense possibly damaging 0.93
R2071:Vmn1r49 UTSW 6 90072202 missense probably benign 0.00
R2155:Vmn1r49 UTSW 6 90072459 missense probably damaging 0.99
R2274:Vmn1r49 UTSW 6 90072144 missense probably benign 0.23
R4222:Vmn1r49 UTSW 6 90072246 missense probably benign 0.06
R4614:Vmn1r49 UTSW 6 90072552 missense probably benign 0.00
R4797:Vmn1r49 UTSW 6 90072630 missense probably benign 0.13
R4978:Vmn1r49 UTSW 6 90072890 missense probably benign 0.30
R5227:Vmn1r49 UTSW 6 90072771 missense probably benign 0.00
R5959:Vmn1r49 UTSW 6 90072804 missense probably damaging 1.00
R6741:Vmn1r49 UTSW 6 90072213 missense probably benign 0.19
R6744:Vmn1r49 UTSW 6 90072202 missense probably benign 0.00
R7173:Vmn1r49 UTSW 6 90072268 missense possibly damaging 0.96
R7457:Vmn1r49 UTSW 6 90072552 missense probably benign 0.00
R7573:Vmn1r49 UTSW 6 90072861 missense probably benign 0.06
R8360:Vmn1r49 UTSW 6 90073009 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTGCTTTCTCTGGAGTAAC -3'
(R):5'- GCTCCTTGGTGAGAACAAGC -3'

Sequencing Primer
(F):5'- TCTCTGGAGTAACTCATGGGTAGAAG -3'
(R):5'- TCCTTGGTGAGAACAAGCCTAAAC -3'
Posted On2020-09-02