Incidental Mutation 'R8399:C1s1'
ID 647760
Institutional Source Beutler Lab
Gene Symbol C1s1
Ensembl Gene ENSMUSG00000038521
Gene Name complement component 1, s subcomponent 1
Synonyms C1s
MMRRC Submission 067762-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8399 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124507304-124519318 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 124512252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 277 (V277I)
Ref Sequence ENSEMBL: ENSMUSP00000125531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160505] [ENSMUST00000162443]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000160505
AA Change: V277I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125531
Gene: ENSMUSG00000038521
AA Change: V277I

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162443
AA Change: V277I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125712
Gene: ENSMUSG00000038521
AA Change: V277I

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,637,289 (GRCm39) V3384D possibly damaging Het
Apba3 C A 10: 81,104,832 (GRCm39) T35N probably benign Het
Bcl6 T C 16: 23,791,698 (GRCm39) M219V probably benign Het
Bco2 T A 9: 50,452,418 (GRCm39) T217S probably benign Het
Ccdc162 T A 10: 41,415,517 (GRCm39) R2149W probably damaging Het
Cers6 T C 2: 68,692,115 (GRCm39) F46L probably benign Het
Chpf T C 1: 75,452,864 (GRCm39) I359V probably benign Het
Chrnb4 A C 9: 54,951,107 (GRCm39) L52R probably benign Het
Cox6a1 T C 5: 115,483,958 (GRCm39) T95A probably damaging Het
Def8 T A 8: 124,182,238 (GRCm39) Y197* probably null Het
Dmbt1 C G 7: 130,684,317 (GRCm39) D778E unknown Het
Dnaaf3 C T 7: 4,526,936 (GRCm39) probably null Het
Dnm1l T A 16: 16,139,536 (GRCm39) H484L probably damaging Het
Eml1 G A 12: 108,504,390 (GRCm39) S783N possibly damaging Het
Frmd4a T C 2: 4,577,244 (GRCm39) S367P probably damaging Het
Hck A C 2: 152,980,237 (GRCm39) K355N probably damaging Het
Hexim2 G T 11: 103,029,329 (GRCm39) R127L probably damaging Het
Hivep2 T C 10: 14,008,178 (GRCm39) L1592P possibly damaging Het
Htr1d G A 4: 136,170,686 (GRCm39) G305E probably damaging Het
Ifi207 G A 1: 173,557,844 (GRCm39) S298L unknown Het
Ighv1-11 A G 12: 114,576,047 (GRCm39) V56A possibly damaging Het
Ighv7-1 G A 12: 113,860,532 (GRCm39) T12I unknown Het
Kctd14 T C 7: 97,106,811 (GRCm39) L22P probably damaging Het
Klra17 T C 6: 129,851,900 (GRCm39) probably benign Het
Kndc1 C T 7: 139,493,434 (GRCm39) R467W probably damaging Het
Maf T A 8: 116,433,251 (GRCm39) I118F unknown Het
Mppe1 T C 18: 67,358,946 (GRCm39) T341A probably benign Het
Mtmr2 T A 9: 13,703,363 (GRCm39) V186E probably benign Het
Nedd9 G T 13: 41,471,950 (GRCm39) Y176* probably null Het
Omd A G 13: 49,743,345 (GRCm39) I132V possibly damaging Het
Or12e10 A C 2: 87,640,568 (GRCm39) M135L probably damaging Het
Or4a39 T C 2: 89,237,028 (GRCm39) T132A probably benign Het
Pcnx4 T A 12: 72,620,985 (GRCm39) M935K probably benign Het
Pecr G A 1: 72,306,624 (GRCm39) T219I probably benign Het
Pkd1l3 C T 8: 110,350,520 (GRCm39) P455L possibly damaging Het
Plcg2 T C 8: 118,323,101 (GRCm39) Y719H probably damaging Het
Plk4 C T 3: 40,763,265 (GRCm39) R479* probably null Het
Pms1 T A 1: 53,307,091 (GRCm39) probably null Het
Raph1 C T 1: 60,528,477 (GRCm39) S928N unknown Het
Rtp4 G T 16: 23,339,164 (GRCm39) probably benign Het
Skor1 C T 9: 63,052,440 (GRCm39) V510I possibly damaging Het
Smg1 T C 7: 117,789,794 (GRCm39) T699A unknown Het
Tcp11l1 T C 2: 104,515,720 (GRCm39) D381G probably benign Het
Tnik T A 3: 28,548,159 (GRCm39) M56K unknown Het
Trappc9 G A 15: 72,924,131 (GRCm39) R204C probably damaging Het
Trmt10b A T 4: 45,305,870 (GRCm39) M184L possibly damaging Het
Vmn1r224 T A 17: 20,640,011 (GRCm39) I196N probably damaging Het
Vmn1r49 A T 6: 90,049,689 (GRCm39) C104* probably null Het
Vmn2r35 A C 7: 7,819,897 (GRCm39) S124R probably benign Het
Wdr62 T C 7: 29,957,486 (GRCm39) E547G probably damaging Het
Zfp68 A T 5: 138,606,082 (GRCm39) D80E probably benign Het
Other mutations in C1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:C1s1 APN 6 124,518,293 (GRCm39) missense probably benign 0.02
IGL02590:C1s1 APN 6 124,508,235 (GRCm39) missense possibly damaging 0.89
IGL02968:C1s1 APN 6 124,517,310 (GRCm39) missense probably damaging 0.99
IGL03301:C1s1 APN 6 124,518,283 (GRCm39) splice site probably benign
BB008:C1s1 UTSW 6 124,510,359 (GRCm39) missense probably damaging 1.00
BB018:C1s1 UTSW 6 124,510,359 (GRCm39) missense probably damaging 1.00
R0105:C1s1 UTSW 6 124,518,277 (GRCm39) splice site probably benign
R0396:C1s1 UTSW 6 124,510,313 (GRCm39) missense probably benign 0.03
R0759:C1s1 UTSW 6 124,508,396 (GRCm39) missense probably damaging 1.00
R1145:C1s1 UTSW 6 124,517,759 (GRCm39) missense probably damaging 1.00
R1145:C1s1 UTSW 6 124,517,759 (GRCm39) missense probably damaging 1.00
R1396:C1s1 UTSW 6 124,508,010 (GRCm39) missense probably damaging 1.00
R1466:C1s1 UTSW 6 124,508,090 (GRCm39) missense probably damaging 1.00
R1466:C1s1 UTSW 6 124,508,090 (GRCm39) missense probably damaging 1.00
R1627:C1s1 UTSW 6 124,514,439 (GRCm39) missense probably damaging 1.00
R1855:C1s1 UTSW 6 124,511,315 (GRCm39) critical splice donor site probably null
R2010:C1s1 UTSW 6 124,514,353 (GRCm39) missense probably damaging 1.00
R2349:C1s1 UTSW 6 124,518,432 (GRCm39) start gained probably benign
R4544:C1s1 UTSW 6 124,508,499 (GRCm39) missense probably benign 0.31
R4661:C1s1 UTSW 6 124,513,449 (GRCm39) missense probably benign 0.22
R5383:C1s1 UTSW 6 124,511,360 (GRCm39) missense probably damaging 1.00
R5687:C1s1 UTSW 6 124,517,909 (GRCm39) missense probably benign 0.01
R5846:C1s1 UTSW 6 124,517,912 (GRCm39) missense possibly damaging 0.93
R6289:C1s1 UTSW 6 124,508,135 (GRCm39) missense probably damaging 0.99
R6410:C1s1 UTSW 6 124,508,117 (GRCm39) missense probably damaging 1.00
R6983:C1s1 UTSW 6 124,517,855 (GRCm39) missense possibly damaging 0.93
R7931:C1s1 UTSW 6 124,510,359 (GRCm39) missense probably damaging 1.00
R8141:C1s1 UTSW 6 124,508,321 (GRCm39) missense probably damaging 1.00
R8341:C1s1 UTSW 6 124,508,115 (GRCm39) missense probably damaging 1.00
R8926:C1s1 UTSW 6 124,513,322 (GRCm39) missense possibly damaging 0.95
R8926:C1s1 UTSW 6 124,510,325 (GRCm39) missense probably damaging 1.00
R9008:C1s1 UTSW 6 124,509,499 (GRCm39) critical splice donor site probably null
R9147:C1s1 UTSW 6 124,517,758 (GRCm39) missense probably damaging 1.00
R9148:C1s1 UTSW 6 124,517,758 (GRCm39) missense probably damaging 1.00
R9153:C1s1 UTSW 6 124,517,906 (GRCm39) missense possibly damaging 0.78
R9177:C1s1 UTSW 6 124,508,362 (GRCm39) missense probably damaging 0.98
RF029:C1s1 UTSW 6 124,518,310 (GRCm39) start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GTTCCCACAAACGTTCCAAAGT -3'
(R):5'- TCCACTAAGGACACTCTCACTT -3'

Sequencing Primer
(F):5'- CAAACGTTCCAAAGTTTCCCATTG -3'
(R):5'- TAAGGACACTCTCACTTCATACC -3'
Posted On 2020-09-02