Incidental Mutation 'R8399:Dnaaf3'
ID647762
Institutional Source Beutler Lab
Gene Symbol Dnaaf3
Ensembl Gene ENSMUSG00000055809
Gene Namedynein, axonemal assembly factor 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4522933-4532453 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 4523937 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094897] [ENSMUST00000098859] [ENSMUST00000140424] [ENSMUST00000154913] [ENSMUST00000209148]
Predicted Effect probably null
Transcript: ENSMUST00000094897
SMART Domains Protein: ENSMUSP00000092498
Gene: ENSMUSG00000055809

DomainStartEndE-ValueType
Pfam:DUF4470 16 122 1.3e-27 PFAM
Pfam:DUF4471 154 436 5.3e-104 PFAM
internal_repeat_1 467 512 1.63e-5 PROSPERO
internal_repeat_1 525 568 1.63e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000098859
SMART Domains Protein: ENSMUSP00000096458
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1e-10 PFAM
Pfam:Troponin 47 178 3.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140424
SMART Domains Protein: ENSMUSP00000115015
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1.1e-14 PFAM
Pfam:Troponin 47 125 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154913
SMART Domains Protein: ENSMUSP00000122916
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 9e-15 PFAM
Pfam:Troponin 47 112 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209148
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the assembly of axonemal inner and outer dynein arms and plays a role in assembling dynein complexes for transport into cilia. Defects in this gene are a cause of primary ciliary dyskinesia type 2 (CILD2). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and complex congenital heart disease associated with heterotaxy, abdominal organ situs anomalies and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Dnaaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02197:Dnaaf3 APN 7 4527497 missense probably damaging 1.00
IGL02319:Dnaaf3 APN 7 4523947 missense probably damaging 1.00
IGL02805:Dnaaf3 APN 7 4523705 missense possibly damaging 0.64
R1818:Dnaaf3 UTSW 7 4523569 splice site probably null
R1818:Dnaaf3 UTSW 7 4523570 missense probably benign 0.35
R2063:Dnaaf3 UTSW 7 4523799 missense possibly damaging 0.87
R2064:Dnaaf3 UTSW 7 4523799 missense possibly damaging 0.87
R2066:Dnaaf3 UTSW 7 4523799 missense possibly damaging 0.87
R2068:Dnaaf3 UTSW 7 4523799 missense possibly damaging 0.87
R2132:Dnaaf3 UTSW 7 4523801 missense probably benign 0.00
R2363:Dnaaf3 UTSW 7 4532277 critical splice acceptor site probably null
R4710:Dnaaf3 UTSW 7 4526494 missense probably damaging 1.00
R4803:Dnaaf3 UTSW 7 4526904 missense probably benign 0.14
R4939:Dnaaf3 UTSW 7 4527145 missense probably damaging 1.00
R5487:Dnaaf3 UTSW 7 4523865 splice site probably null
R5846:Dnaaf3 UTSW 7 4523687 missense possibly damaging 0.73
R6084:Dnaaf3 UTSW 7 4524213 missense probably benign 0.00
R6218:Dnaaf3 UTSW 7 4523672 missense probably benign 0.23
R6576:Dnaaf3 UTSW 7 4523380 missense probably benign 0.41
R6916:Dnaaf3 UTSW 7 4527533 missense probably damaging 1.00
R7219:Dnaaf3 UTSW 7 4528077 missense probably damaging 1.00
Z1088:Dnaaf3 UTSW 7 4523795 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTCGCAAAAGTCTCCGAG -3'
(R):5'- AAGAGACCTAGGATTGGGCC -3'

Sequencing Primer
(F):5'- CGCAAAAGTCTCCGAGGGTTTG -3'
(R):5'- GCCCCAGTTTATTCGTTGTCAGAAG -3'
Posted On2020-09-02