Incidental Mutation 'R8399:Kctd14'
ID647765
Institutional Source Beutler Lab
Gene Symbol Kctd14
Ensembl Gene ENSMUSG00000051727
Gene Namepotassium channel tetramerisation domain containing 14
SynonymsD7Ertd760e, AI449310
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location97451323-97459557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97457604 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 22 (L22P)
Ref Sequence ENSEMBL: ENSMUSP00000060557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050732] [ENSMUST00000121987] [ENSMUST00000143321] [ENSMUST00000205577] [ENSMUST00000206279] [ENSMUST00000206658]
Predicted Effect probably damaging
Transcript: ENSMUST00000050732
AA Change: L22P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060557
Gene: ENSMUSG00000051727
AA Change: L22P

DomainStartEndE-ValueType
BTB 18 115 4.06e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121987
SMART Domains Protein: ENSMUSP00000113765
Gene: ENSMUSG00000051727

DomainStartEndE-ValueType
BTB 18 115 4.06e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143321
Predicted Effect probably damaging
Transcript: ENSMUST00000205577
AA Change: L22P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206279
AA Change: L54P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206658
AA Change: L75P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Kctd14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Kctd14 APN 7 97457712 missense possibly damaging 0.81
R1525:Kctd14 UTSW 7 97457867 missense probably benign 0.02
R1853:Kctd14 UTSW 7 97453424 missense possibly damaging 0.95
R4772:Kctd14 UTSW 7 97457676 missense probably damaging 0.99
R6093:Kctd14 UTSW 7 97454953 intron probably benign
R6234:Kctd14 UTSW 7 97458012 missense probably damaging 1.00
R7283:Kctd14 UTSW 7 97451486 start codon destroyed probably null
R7480:Kctd14 UTSW 7 97458224 missense probably benign 0.00
R7736:Kctd14 UTSW 7 97457940 missense probably damaging 1.00
R7940:Kctd14 UTSW 7 97457684 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTACCCAGACAGGTTGAGAG -3'
(R):5'- TACCTCAGGAACGTACTCTGTG -3'

Sequencing Primer
(F):5'- TTGAGAGATGAGGGCTCCACAC -3'
(R):5'- AGGAACGTACTCTGTGGGCAC -3'
Posted On2020-09-02