Incidental Mutation 'R8399:Def8'
ID647772
Institutional Source Beutler Lab
Gene Symbol Def8
Ensembl Gene ENSMUSG00000001482
Gene Namedifferentially expressed in FDCP 8
SynonymsD8Ertd713e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location123423527-123463270 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 123455499 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 197 (Y197*)
Ref Sequence ENSEMBL: ENSMUSP00000090737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001522] [ENSMUST00000065534] [ENSMUST00000093049] [ENSMUST00000108830] [ENSMUST00000108832] [ENSMUST00000124741] [ENSMUST00000127664] [ENSMUST00000128424] [ENSMUST00000132063] [ENSMUST00000212391] [ENSMUST00000212827] [ENSMUST00000212883]
Predicted Effect probably null
Transcript: ENSMUST00000001522
AA Change: Y209*
SMART Domains Protein: ENSMUSP00000001522
Gene: ENSMUSG00000001482
AA Change: Y209*

DomainStartEndE-ValueType
Blast:DUF4206 77 133 8e-28 BLAST
C1 148 198 4.12e-3 SMART
DUF4206 243 447 4.01e-121 SMART
C1 385 437 1.5e0 SMART
RING 399 440 4.86e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065534
AA Change: Y197*
SMART Domains Protein: ENSMUSP00000070579
Gene: ENSMUSG00000001482
AA Change: Y197*

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093049
AA Change: Y197*
SMART Domains Protein: ENSMUSP00000090737
Gene: ENSMUSG00000001482
AA Change: Y197*

DomainStartEndE-ValueType
Blast:DUF4206 65 121 9e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 429 6.85e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108830
AA Change: Y197*
SMART Domains Protein: ENSMUSP00000104458
Gene: ENSMUSG00000001482
AA Change: Y197*

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108832
AA Change: Y221*
SMART Domains Protein: ENSMUSP00000104460
Gene: ENSMUSG00000001482
AA Change: Y221*

DomainStartEndE-ValueType
Blast:DUF4206 89 145 9e-28 BLAST
C1 160 210 4.12e-3 SMART
DUF4206 255 459 4.01e-121 SMART
C1 397 449 1.5e0 SMART
RING 411 452 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124741
SMART Domains Protein: ENSMUSP00000122532
Gene: ENSMUSG00000001482

DomainStartEndE-ValueType
Blast:DUF4206 65 97 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128424
AA Change: Y209*
SMART Domains Protein: ENSMUSP00000115137
Gene: ENSMUSG00000001482
AA Change: Y209*

DomainStartEndE-ValueType
Blast:DUF4206 77 133 4e-30 BLAST
C1 148 198 4.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132063
Predicted Effect probably benign
Transcript: ENSMUST00000212391
Predicted Effect probably benign
Transcript: ENSMUST00000212827
Predicted Effect probably benign
Transcript: ENSMUST00000212883
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Def8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Def8 APN 8 123459650 missense possibly damaging 0.95
IGL01896:Def8 APN 8 123459895 missense probably benign 0.29
IGL02424:Def8 APN 8 123459648 missense possibly damaging 0.65
IGL02982:Def8 APN 8 123456539 unclassified probably benign
IGL03218:Def8 APN 8 123456436 missense probably damaging 1.00
defensive UTSW 8 123454322 missense probably damaging 1.00
PIT4495001:Def8 UTSW 8 123459553 missense probably benign 0.00
R0003:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0117:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0119:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0135:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0138:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0141:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0408:Def8 UTSW 8 123459917 missense probably damaging 1.00
R0636:Def8 UTSW 8 123454357 nonsense probably null
R3890:Def8 UTSW 8 123458344 unclassified probably benign
R3891:Def8 UTSW 8 123458344 unclassified probably benign
R3892:Def8 UTSW 8 123458344 unclassified probably benign
R4904:Def8 UTSW 8 123461480 missense probably damaging 0.96
R5930:Def8 UTSW 8 123460070 unclassified probably benign
R6088:Def8 UTSW 8 123460048 nonsense probably null
R6577:Def8 UTSW 8 123456710 missense probably benign 0.01
R7446:Def8 UTSW 8 123454322 missense probably damaging 1.00
R7498:Def8 UTSW 8 123447844 missense probably damaging 1.00
R7770:Def8 UTSW 8 123460059 missense unknown
R7827:Def8 UTSW 8 123447321 missense probably benign
R8186:Def8 UTSW 8 123461476 nonsense probably null
R8256:Def8 UTSW 8 123459629 missense probably damaging 1.00
Z1088:Def8 UTSW 8 123456498 missense probably damaging 0.96
Z1176:Def8 UTSW 8 123459966 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TATGGACATTACAGGGAAGCC -3'
(R):5'- TTATGTAGCTGCCGTAGAGAGC -3'

Sequencing Primer
(F):5'- CATTACAGGGAAGCCAATGGTGTG -3'
(R):5'- GCCGTAGAGAGCTTTCTCACAC -3'
Posted On2020-09-02