Incidental Mutation 'R8399:Chrnb4'
ID647775
Institutional Source Beutler Lab
Gene Symbol Chrnb4
Ensembl Gene ENSMUSG00000035200
Gene Namecholinergic receptor, nicotinic, beta polypeptide 4
SynonymsAcrb-4, Acrb4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location55028154-55048779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 55043823 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 52 (L52R)
Ref Sequence ENSEMBL: ENSMUSP00000034854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034854]
Predicted Effect probably benign
Transcript: ENSMUST00000034854
AA Change: L52R

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034854
Gene: ENSMUSG00000035200
AA Change: L52R

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 231 3.2e-70 PFAM
Pfam:Neur_chan_memb 238 481 6.1e-88 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in hyperplasia of the bladder and altered bladder contractility. Mutant mice also exhibit a resistance to nicotine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Chrnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Chrnb4 APN 9 55036594 missense probably damaging 1.00
IGL02207:Chrnb4 APN 9 55035216 missense probably damaging 1.00
IGL03242:Chrnb4 APN 9 55035528 missense probably damaging 1.00
R0345:Chrnb4 UTSW 9 55035594 missense probably benign
R0735:Chrnb4 UTSW 9 55043800 missense probably damaging 0.96
R1843:Chrnb4 UTSW 9 55034818 missense possibly damaging 0.93
R1975:Chrnb4 UTSW 9 55034818 missense probably damaging 0.99
R2204:Chrnb4 UTSW 9 55043848 missense probably damaging 1.00
R2427:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R3876:Chrnb4 UTSW 9 55043898 missense probably damaging 1.00
R4934:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R5094:Chrnb4 UTSW 9 55035313 missense probably benign 0.00
R5507:Chrnb4 UTSW 9 55035012 missense probably damaging 1.00
R6370:Chrnb4 UTSW 9 55034859 missense probably benign 0.00
R7556:Chrnb4 UTSW 9 55035055 missense probably benign 0.19
X0062:Chrnb4 UTSW 9 55034680 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGTTACCCATCTGTCAAGGTCAG -3'
(R):5'- TACATAGCTCCAGGGCTCCTAC -3'

Sequencing Primer
(F):5'- TCAAGGTCAGAAGTAACATGCCTGTC -3'
(R):5'- AGGGCTCCTACACTCTGC -3'
Posted On2020-09-02