Incidental Mutation 'R8399:Skor1'
ID647776
Institutional Source Beutler Lab
Gene Symbol Skor1
Ensembl Gene ENSMUSG00000022245
Gene NameSKI family transcriptional corepressor 1
SynonymsCorl1, C230094B15Rik, Lbxcor1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.503) question?
Stock #R8399 (G1)
Quality Score224.009
Status Not validated
Chromosome9
Chromosomal Location63138170-63148961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63145158 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 510 (V510I)
Ref Sequence ENSEMBL: ENSMUSP00000055037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055281] [ENSMUST00000116613] [ENSMUST00000119146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055281
AA Change: V510I

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000055037
Gene: ENSMUSG00000022245
AA Change: V510I

DomainStartEndE-ValueType
Pfam:Ski_Sno 61 168 3.2e-41 PFAM
c-SKI_SMAD_bind 180 272 2.48e-56 SMART
low complexity region 284 312 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
low complexity region 345 366 N/A INTRINSIC
low complexity region 379 398 N/A INTRINSIC
low complexity region 414 454 N/A INTRINSIC
low complexity region 465 479 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 568 582 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
SCOP:d1eq1a_ 850 937 1e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116613
AA Change: V471I

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112312
Gene: ENSMUSG00000022245
AA Change: V471I

DomainStartEndE-ValueType
Pfam:Ski_Sno 17 130 3.5e-42 PFAM
c-SKI_SMAD_bind 141 233 2.48e-56 SMART
low complexity region 245 273 N/A INTRINSIC
low complexity region 294 303 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
low complexity region 340 359 N/A INTRINSIC
low complexity region 375 415 N/A INTRINSIC
low complexity region 426 440 N/A INTRINSIC
low complexity region 463 486 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
SCOP:d1eq1a_ 811 898 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119146
AA Change: V482I

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113924
Gene: ENSMUSG00000022245
AA Change: V482I

DomainStartEndE-ValueType
Pfam:Ski_Sno 28 141 3e-42 PFAM
c-SKI_SMAD_bind 152 244 2.48e-56 SMART
low complexity region 256 284 N/A INTRINSIC
low complexity region 305 314 N/A INTRINSIC
low complexity region 317 338 N/A INTRINSIC
low complexity region 351 370 N/A INTRINSIC
low complexity region 386 426 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
low complexity region 474 497 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
SCOP:d1eq1a_ 822 909 1e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Skor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Skor1 APN 9 63146441 missense probably damaging 1.00
IGL00736:Skor1 APN 9 63139538 missense probably damaging 0.99
IGL01344:Skor1 APN 9 63142278 missense possibly damaging 0.79
IGL01383:Skor1 APN 9 63146556 missense probably benign 0.12
IGL01456:Skor1 APN 9 63145490 missense probably damaging 1.00
IGL02503:Skor1 APN 9 63146115 missense probably damaging 1.00
IGL02526:Skor1 APN 9 63145877 missense probably damaging 1.00
IGL02699:Skor1 APN 9 63140046 splice site probably benign
R0041:Skor1 UTSW 9 63145851 missense probably damaging 1.00
R0092:Skor1 UTSW 9 63145995 missense probably damaging 1.00
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1581:Skor1 UTSW 9 63146223 missense probably damaging 1.00
R1598:Skor1 UTSW 9 63146004 missense probably damaging 1.00
R2172:Skor1 UTSW 9 63145122 missense possibly damaging 0.84
R3734:Skor1 UTSW 9 63140068 missense probably damaging 1.00
R3803:Skor1 UTSW 9 63145586 missense probably benign 0.06
R3839:Skor1 UTSW 9 63144448 missense probably damaging 0.97
R4627:Skor1 UTSW 9 63145476 missense probably damaging 1.00
R4698:Skor1 UTSW 9 63144548 missense probably benign
R4712:Skor1 UTSW 9 63139573 splice site probably null
R4781:Skor1 UTSW 9 63144459 missense probably benign
R5089:Skor1 UTSW 9 63145923 missense probably damaging 0.99
R5735:Skor1 UTSW 9 63146064 missense probably damaging 1.00
R6279:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6300:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6396:Skor1 UTSW 9 63144950 missense probably damaging 1.00
R6791:Skor1 UTSW 9 63140354 splice site probably null
R7371:Skor1 UTSW 9 63146887 splice site probably null
R7448:Skor1 UTSW 9 63146103 missense probably damaging 1.00
R7491:Skor1 UTSW 9 63146448 missense probably damaging 0.99
R7496:Skor1 UTSW 9 63146850 missense probably benign 0.02
R7606:Skor1 UTSW 9 63145382 missense probably damaging 1.00
R7664:Skor1 UTSW 9 63141763 missense probably benign 0.08
R7689:Skor1 UTSW 9 63145379 missense probably damaging 1.00
R7793:Skor1 UTSW 9 63144885 missense probably damaging 1.00
R7871:Skor1 UTSW 9 63146501 missense probably damaging 1.00
R7911:Skor1 UTSW 9 63145046 missense possibly damaging 0.50
Z1176:Skor1 UTSW 9 63145130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCTTAACTACGGGTCGGAAGG -3'
(R):5'- GCACAATGTTCTGGGGACATC -3'

Sequencing Primer
(F):5'- AGGCTGACACGTAGGAGCTTTTG -3'
(R):5'- AATGTTCTGGGGACATCAACCTTC -3'
Posted On2020-09-02