Incidental Mutation 'R8399:Ighv7-1'
ID647783
Institutional Source Beutler Lab
Gene Symbol Ighv7-1
Ensembl Gene ENSMUSG00000076665
Gene Nameimmunoglobulin heavy variable 7-1
SynonymsGm16698
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location113896408-113896946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113896912 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 12 (T12I)
Ref Sequence ENSEMBL: ENSMUSP00000100255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103474]
Predicted Effect unknown
Transcript: ENSMUST00000103474
AA Change: T12I
SMART Domains Protein: ENSMUSP00000100255
Gene: ENSMUSG00000076665
AA Change: T12I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 119 6.1e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Ighv7-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Ighv7-1 APN 12 113896503 missense possibly damaging 0.78
IGL03006:Ighv7-1 APN 12 113896525 missense probably damaging 1.00
IGL03051:Ighv7-1 APN 12 113896956 unclassified probably benign
IGL03281:Ighv7-1 APN 12 113896951 unclassified probably benign
R3008:Ighv7-1 UTSW 12 113896451 missense probably damaging 1.00
R5754:Ighv7-1 UTSW 12 113896619 missense probably damaging 0.99
R6172:Ighv7-1 UTSW 12 113896563 missense probably damaging 0.99
R6213:Ighv7-1 UTSW 12 113896521 missense probably damaging 0.99
R7324:Ighv7-1 UTSW 12 113896529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACACTGGATACCTGCAATAG -3'
(R):5'- TCACTCTCTACAACTTCAATCCTAGAG -3'

Sequencing Primer
(F):5'- CACACTGGATACCTGCAATAGTAGAG -3'
(R):5'- CTACAACTTCAATCCTAGAGCTAATG -3'
Posted On2020-09-02