Incidental Mutation 'R8399:Trappc9'
ID647788
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73052282 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 204 (R204C)
Ref Sequence ENSEMBL: ENSMUSP00000087202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: R16C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R16C

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089770
AA Change: R204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R204C

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168191
AA Change: R204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: R204C

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170633
AA Change: R204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: R204C

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228960
AA Change: R204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- TGAGCCCACAGAGCAATTAGC -3'
(R):5'- AATGACTGCTGCTGGCTTC -3'

Sequencing Primer
(F):5'- GTGCCATTTCCTCATAGTCAAATAC -3'
(R):5'- GCTGGCTTCCAACCTTAGAG -3'
Posted On2020-09-02