Mutagenetix > Incidental Mutations

Incidental Mutation 'R8399:Trappc9'

647788

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8399 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73052282 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 204 (R204C)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: R16C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R16C

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089770
AA Change: R204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R204C

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168191
AA Change: R204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: R204C

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170633
AA Change: R204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: R204C

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000228960
AA Change: R204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,489,170	V3384D	possibly damaging	Het
Apba3	C	A	10: 81,268,998	T35N	probably benign	Het
Bcl6	T	C	16: 23,972,948	M219V	probably benign	Het
Bco2	T	A	9: 50,541,118	T217S	probably benign	Het
C1s1	C	T	6: 124,535,293	V277I	probably benign	Het
Ccdc162	T	A	10: 41,539,521	R2149W	probably damaging	Het
Cers6	T	C	2: 68,861,771	F46L	probably benign	Het
Chpf	T	C	1: 75,476,220	I359V	probably benign	Het
Chrnb4	A	C	9: 55,043,823	L52R	probably benign	Het
Cox6a1	T	C	5: 115,345,899	T95A	probably damaging	Het
Def8	T	A	8: 123,455,499	Y197*	probably null	Het
Dmbt1	C	G	7: 131,082,587	D778E	unknown	Het
Dnaaf3	C	T	7: 4,523,937		probably null	Het
Dnm1l	T	A	16: 16,321,672	H484L	probably damaging	Het
Eml1	G	A	12: 108,538,131	S783N	possibly damaging	Het
Frmd4a	T	C	2: 4,572,433	S367P	probably damaging	Het
Hck	A	C	2: 153,138,317	K355N	probably damaging	Het
Hexim2	G	T	11: 103,138,503	R127L	probably damaging	Het
Hivep2	T	C	10: 14,132,434	L1592P	possibly damaging	Het
Htr1d	G	A	4: 136,443,375	G305E	probably damaging	Het
Ifi207	G	A	1: 173,730,278	S298L	unknown	Het
Ighv1-11	A	G	12: 114,612,427	V56A	possibly damaging	Het
Ighv7-1	G	A	12: 113,896,912	T12I	unknown	Het
Kctd14	T	C	7: 97,457,604	L22P	probably damaging	Het
Klra17	T	C	6: 129,874,937		probably benign	Het
Kndc1	C	T	7: 139,913,518	R467W	probably damaging	Het
Maf	T	A	8: 115,706,512	I118F	unknown	Het
Mppe1	T	C	18: 67,225,875	T341A	probably benign	Het
Mtmr2	T	A	9: 13,792,067	V186E	probably benign	Het
Nedd9	G	T	13: 41,318,474	Y176*	probably null	Het
Olfr1145	A	C	2: 87,810,224	M135L	probably damaging	Het
Olfr1238	T	C	2: 89,406,684	T132A	probably benign	Het
Omd	A	G	13: 49,589,869	I132V	possibly damaging	Het
Pcnx4	T	A	12: 72,574,211	M935K	probably benign	Het
Pecr	G	A	1: 72,267,465	T219I	probably benign	Het
Pkd1l3	C	T	8: 109,623,888	P455L	possibly damaging	Het
Plcg2	T	C	8: 117,596,362	Y719H	probably damaging	Het
Plk4	C	T	3: 40,808,830	R479*	probably null	Het
Pms1	T	A	1: 53,267,932		probably null	Het
Raph1	C	T	1: 60,489,318	S928N	unknown	Het
Rtp4	G	T	16: 23,520,414		probably benign	Het
Skor1	C	T	9: 63,145,158	V510I	possibly damaging	Het
Smg1	T	C	7: 118,190,571	T699A	unknown	Het
Tcp11l1	T	C	2: 104,685,375	D381G	probably benign	Het
Tnik	T	A	3: 28,494,010	M56K	unknown	Het
Trmt10b	A	T	4: 45,305,870	M184L	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,749	I196N	probably damaging	Het
Vmn1r49	A	T	6: 90,072,707	C104*	probably null	Het
Vmn2r35	A	C	7: 7,816,898	S124R	probably benign	Het
Wdr62	T	C	7: 30,258,061	E547G	probably damaging	Het
Zfp68	A	T	5: 138,607,820	D80E	probably benign	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- TGAGCCCACAGAGCAATTAGC -3'
(R):5'- AATGACTGCTGCTGGCTTC -3'

Sequencing Primer
(F):5'- GTGCCATTTCCTCATAGTCAAATAC -3'
(R):5'- GCTGGCTTCCAACCTTAGAG -3'

Posted On

2020-09-02