Mutagenetix > Incidental Mutations

Incidental Mutation 'R8399:Bcl6'

647791

Institutional Source

Beutler Lab

Gene Symbol

Bcl6

Ensembl Gene

ENSMUSG00000022508

Gene Name

B cell leukemia/lymphoma 6

Synonyms

Bcl5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R8399 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23965052-23988852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23972948 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 219 (M219V)

Ref Sequence

ENSEMBL: ENSMUSP00000023151 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023151]

Predicted Effect

probably benign
Transcript: ENSMUST00000023151
AA Change: M219V

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508
AA Change: M219V

Domain	Start	End	E-Value	Type
BTB	32	129	4.86e-28	SMART
low complexity region	406	422	N/A	INTRINSIC
low complexity region	458	467	N/A	INTRINSIC
ZnF_C2H2	519	542	1.33e-1	SMART
ZnF_C2H2	547	569	1.67e-2	SMART
ZnF_C2H2	575	597	2.79e-4	SMART
ZnF_C2H2	603	625	3.89e-3	SMART
ZnF_C2H2	631	653	8.47e-4	SMART
ZnF_C2H2	659	682	4.11e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,489,170	V3384D	possibly damaging	Het
Apba3	C	A	10: 81,268,998	T35N	probably benign	Het
Bco2	T	A	9: 50,541,118	T217S	probably benign	Het
C1s1	C	T	6: 124,535,293	V277I	probably benign	Het
Ccdc162	T	A	10: 41,539,521	R2149W	probably damaging	Het
Cers6	T	C	2: 68,861,771	F46L	probably benign	Het
Chpf	T	C	1: 75,476,220	I359V	probably benign	Het
Chrnb4	A	C	9: 55,043,823	L52R	probably benign	Het
Cox6a1	T	C	5: 115,345,899	T95A	probably damaging	Het
Def8	T	A	8: 123,455,499	Y197*	probably null	Het
Dmbt1	C	G	7: 131,082,587	D778E	unknown	Het
Dnaaf3	C	T	7: 4,523,937		probably null	Het
Dnm1l	T	A	16: 16,321,672	H484L	probably damaging	Het
Eml1	G	A	12: 108,538,131	S783N	possibly damaging	Het
Frmd4a	T	C	2: 4,572,433	S367P	probably damaging	Het
Hck	A	C	2: 153,138,317	K355N	probably damaging	Het
Hexim2	G	T	11: 103,138,503	R127L	probably damaging	Het
Hivep2	T	C	10: 14,132,434	L1592P	possibly damaging	Het
Htr1d	G	A	4: 136,443,375	G305E	probably damaging	Het
Ifi207	G	A	1: 173,730,278	S298L	unknown	Het
Ighv1-11	A	G	12: 114,612,427	V56A	possibly damaging	Het
Ighv7-1	G	A	12: 113,896,912	T12I	unknown	Het
Kctd14	T	C	7: 97,457,604	L22P	probably damaging	Het
Klra17	T	C	6: 129,874,937		probably benign	Het
Kndc1	C	T	7: 139,913,518	R467W	probably damaging	Het
Maf	T	A	8: 115,706,512	I118F	unknown	Het
Mppe1	T	C	18: 67,225,875	T341A	probably benign	Het
Mtmr2	T	A	9: 13,792,067	V186E	probably benign	Het
Nedd9	G	T	13: 41,318,474	Y176*	probably null	Het
Olfr1145	A	C	2: 87,810,224	M135L	probably damaging	Het
Olfr1238	T	C	2: 89,406,684	T132A	probably benign	Het
Omd	A	G	13: 49,589,869	I132V	possibly damaging	Het
Pcnx4	T	A	12: 72,574,211	M935K	probably benign	Het
Pecr	G	A	1: 72,267,465	T219I	probably benign	Het
Pkd1l3	C	T	8: 109,623,888	P455L	possibly damaging	Het
Plcg2	T	C	8: 117,596,362	Y719H	probably damaging	Het
Plk4	C	T	3: 40,808,830	R479*	probably null	Het
Pms1	T	A	1: 53,267,932		probably null	Het
Raph1	C	T	1: 60,489,318	S928N	unknown	Het
Rtp4	G	T	16: 23,520,414		probably benign	Het
Skor1	C	T	9: 63,145,158	V510I	possibly damaging	Het
Smg1	T	C	7: 118,190,571	T699A	unknown	Het
Tcp11l1	T	C	2: 104,685,375	D381G	probably benign	Het
Tnik	T	A	3: 28,494,010	M56K	unknown	Het
Trappc9	G	A	15: 73,052,282	R204C	probably damaging	Het
Trmt10b	A	T	4: 45,305,870	M184L	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,749	I196N	probably damaging	Het
Vmn1r49	A	T	6: 90,072,707	C104*	probably null	Het
Vmn2r35	A	C	7: 7,816,898	S124R	probably benign	Het
Wdr62	T	C	7: 30,258,061	E547G	probably damaging	Het
Zfp68	A	T	5: 138,607,820	D80E	probably benign	Het

Other mutations in Bcl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02220:Bcl6	APN	16	23974891	missense	probably damaging	1.00
IGL02505:Bcl6	APN	16	23977569	missense	probably damaging	1.00
IGL03052:Bcl6	APN	16	23975038	splice site	probably benign
IGL03271:Bcl6	APN	16	23970006	missense	probably benign	0.00
Adriatic	UTSW	16	23968133	missense	probably damaging	0.99
Catanzaro	UTSW	16	23966226	nonsense	probably null
Density	UTSW	16	23970048	missense	possibly damaging	0.91
nouvelle	UTSW	16	23969986	missense	possibly damaging	0.92
R0220:Bcl6	UTSW	16	23966219	missense	possibly damaging	0.95
R0401:Bcl6	UTSW	16	23972594	missense	probably damaging	0.97
R0734:Bcl6	UTSW	16	23968139	missense	probably damaging	0.99
R1105:Bcl6	UTSW	16	23966155	missense	probably benign
R1134:Bcl6	UTSW	16	23968365	missense	probably benign
R1317:Bcl6	UTSW	16	23977542	missense	probably damaging	1.00
R1325:Bcl6	UTSW	16	23972347	missense	probably benign	0.02
R1393:Bcl6	UTSW	16	23977566	missense	probably damaging	0.99
R1761:Bcl6	UTSW	16	23977542	missense	probably damaging	1.00
R2170:Bcl6	UTSW	16	23974930	missense	probably damaging	1.00
R2220:Bcl6	UTSW	16	23972632	nonsense	probably null
R2293:Bcl6	UTSW	16	23977609	missense	probably damaging	0.98
R2907:Bcl6	UTSW	16	23968119	missense	probably damaging	1.00
R3900:Bcl6	UTSW	16	23977554	missense	possibly damaging	0.94
R4681:Bcl6	UTSW	16	23968453	intron	probably benign
R5015:Bcl6	UTSW	16	23974850	missense	probably damaging	0.98
R5112:Bcl6	UTSW	16	23972746	missense	probably benign
R5185:Bcl6	UTSW	16	23972947	missense	possibly damaging	0.77
R5371:Bcl6	UTSW	16	23969986	missense	possibly damaging	0.92
R5586:Bcl6	UTSW	16	23973176	missense	probably benign	0.01
R5659:Bcl6	UTSW	16	23968409	nonsense	probably null
R5909:Bcl6	UTSW	16	23972806	missense	probably benign
R6384:Bcl6	UTSW	16	23974865	missense	probably damaging	1.00
R7036:Bcl6	UTSW	16	23974861	missense	probably damaging	1.00
R7097:Bcl6	UTSW	16	23972614	missense	possibly damaging	0.94
R7097:Bcl6	UTSW	16	23972902	missense	probably damaging	1.00
R7122:Bcl6	UTSW	16	23972902	missense	probably damaging	1.00
R7153:Bcl6	UTSW	16	23966226	nonsense	probably null
R7154:Bcl6	UTSW	16	23966226	nonsense	probably null
R7155:Bcl6	UTSW	16	23966226	nonsense	probably null
R7156:Bcl6	UTSW	16	23966226	nonsense	probably null
R7163:Bcl6	UTSW	16	23966226	nonsense	probably null
R7164:Bcl6	UTSW	16	23966226	nonsense	probably null
R7434:Bcl6	UTSW	16	23970048	missense	possibly damaging	0.91
R7727:Bcl6	UTSW	16	23971413	critical splice donor site	probably null
R7914:Bcl6	UTSW	16	23970011	missense	possibly damaging	0.68
R8230:Bcl6	UTSW	16	23972902	missense	probably damaging	1.00
R8243:Bcl6	UTSW	16	23968133	missense	probably damaging	0.99
Z1176:Bcl6	UTSW	16	23969958	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTATGTCACTCCGAGCCTC -3'
(R):5'- AGTTCCTGAACAGCCGGATG -3'

Sequencing Primer
(F):5'- AGCCTCCTCTGGGACTG -3'
(R):5'- GATGCTGATGCCCCATGACATC -3'

Posted On

2020-09-02