Incidental Mutation 'R8400:Atp1a4'
ID 647797
Institutional Source Beutler Lab
Gene Symbol Atp1a4
Ensembl Gene ENSMUSG00000007107
Gene Name ATPase, Na+/K+ transporting, alpha 4 polypeptide
Synonyms
MMRRC Submission 067763-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 172051080-172085981 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 172062061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 688 (D688V)
Ref Sequence ENSEMBL: ENSMUSP00000106874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111243]
AlphaFold Q9WV27
Predicted Effect probably damaging
Transcript: ENSMUST00000111243
AA Change: D688V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: D688V

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Cation_ATPase_N 51 125 1.22e-14 SMART
Pfam:E1-E2_ATPase 144 375 2.6e-59 PFAM
Pfam:Hydrolase 380 738 8.1e-19 PFAM
Pfam:HAD 383 735 1.6e-17 PFAM
Pfam:Cation_ATPase 437 531 9.2e-25 PFAM
Pfam:Cation_ATPase_C 808 1017 1.2e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,243,925 (GRCm39) M1929I probably benign Het
Abca13 T C 11: 9,248,218 (GRCm39) I2655T probably damaging Het
Acad10 A G 5: 121,764,268 (GRCm39) V887A possibly damaging Het
Acot10 T C 15: 20,666,258 (GRCm39) E161G possibly damaging Het
Astn1 C T 1: 158,484,670 (GRCm39) P919L probably benign Het
C4bp C A 1: 130,564,484 (GRCm39) C400F probably damaging Het
Col6a6 A C 9: 105,651,995 (GRCm39) D1005E probably damaging Het
Csnk1g3 C T 18: 54,086,360 (GRCm39) R422C probably benign Het
Cutc T C 19: 43,741,644 (GRCm39) S15P probably benign Het
Dgkb T C 12: 38,652,837 (GRCm39) probably null Het
Disc1 T C 8: 125,959,732 (GRCm39) V748A probably benign Het
Dmbt1 C G 7: 130,684,317 (GRCm39) D778E unknown Het
Dmxl2 T C 9: 54,291,037 (GRCm39) Y2471C probably benign Het
Fam185a T A 5: 21,643,814 (GRCm39) N243K probably benign Het
Fchsd2 A T 7: 100,902,780 (GRCm39) Q386L possibly damaging Het
Gm904 C A 13: 50,797,453 (GRCm39) P49Q probably damaging Het
H2-Q10 C T 17: 35,781,374 (GRCm39) R59C probably damaging Het
Ier5l A G 2: 30,363,105 (GRCm39) Y307H possibly damaging Het
Kmt2e C A 5: 23,702,090 (GRCm39) T906K probably benign Het
Kndc1 C T 7: 139,493,434 (GRCm39) R467W probably damaging Het
Muc5ac C A 7: 141,364,213 (GRCm39) T2508K probably damaging Het
Nlrp9a A T 7: 26,264,431 (GRCm39) M784L probably benign Het
Nlrp9b T A 7: 19,757,937 (GRCm39) C391* probably null Het
Nubp2 A C 17: 25,103,439 (GRCm39) M146R probably damaging Het
Or10q3 T A 19: 11,848,578 (GRCm39) M1L probably damaging Het
Or1a1b C T 11: 74,097,221 (GRCm39) V274M possibly damaging Het
Or2ag1b T A 7: 106,288,876 (GRCm39) S21C probably benign Het
Or2b2 G A 13: 21,888,085 (GRCm39) V305M probably benign Het
Or4k45 A T 2: 111,395,747 (GRCm39) L14H probably damaging Het
Or7e166 A T 9: 19,624,389 (GRCm39) N89Y probably benign Het
Otud1 T C 2: 19,663,189 (GRCm39) V106A possibly damaging Het
Pcdhac1 T A 18: 37,225,453 (GRCm39) Y755* probably null Het
Pkd1l3 C T 8: 110,350,520 (GRCm39) P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,119,477 (GRCm39) probably benign Het
Samhd1 T C 2: 156,941,353 (GRCm39) E648G probably benign Het
Smarca5 T C 8: 81,435,756 (GRCm39) T794A probably benign Het
Spc24 A T 9: 21,669,026 (GRCm39) L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stra6l G A 4: 45,864,905 (GRCm39) R77Q probably damaging Het
Tdrd1 G A 19: 56,837,081 (GRCm39) V472M probably benign Het
Tsc2 A T 17: 24,823,961 (GRCm39) I948K possibly damaging Het
Ttc39d T C 17: 80,523,434 (GRCm39) V31A probably benign Het
Vmn1r158 A T 7: 22,489,305 (GRCm39) C301* probably null Het
Vmn2r22 A T 6: 123,614,486 (GRCm39) L368* probably null Het
Vmn2r79 A G 7: 86,651,308 (GRCm39) T236A probably benign Het
Vwa1 T C 4: 155,857,225 (GRCm39) H191R probably benign Het
Zdbf2 T A 1: 63,344,135 (GRCm39) V838E possibly damaging Het
Other mutations in Atp1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Atp1a4 APN 1 172,067,373 (GRCm39) missense probably damaging 1.00
IGL00924:Atp1a4 APN 1 172,074,339 (GRCm39) missense probably damaging 1.00
IGL01288:Atp1a4 APN 1 172,085,474 (GRCm39) missense possibly damaging 0.77
IGL01665:Atp1a4 APN 1 172,074,291 (GRCm39) missense probably benign
IGL02156:Atp1a4 APN 1 172,085,529 (GRCm39) missense probably benign
IGL02170:Atp1a4 APN 1 172,062,103 (GRCm39) missense possibly damaging 0.94
IGL02228:Atp1a4 APN 1 172,082,452 (GRCm39) missense possibly damaging 0.69
IGL02505:Atp1a4 APN 1 172,062,642 (GRCm39) missense probably damaging 1.00
IGL02653:Atp1a4 APN 1 172,078,973 (GRCm39) missense possibly damaging 0.81
IGL02792:Atp1a4 APN 1 172,054,866 (GRCm39) critical splice donor site probably null
IGL02794:Atp1a4 APN 1 172,071,653 (GRCm39) missense probably benign 0.13
IGL03102:Atp1a4 APN 1 172,058,718 (GRCm39) missense probably damaging 1.00
R0046:Atp1a4 UTSW 1 172,067,664 (GRCm39) missense probably benign 0.09
R0046:Atp1a4 UTSW 1 172,067,664 (GRCm39) missense probably benign 0.09
R0276:Atp1a4 UTSW 1 172,085,468 (GRCm39) missense probably damaging 1.00
R0309:Atp1a4 UTSW 1 172,062,554 (GRCm39) missense probably damaging 1.00
R0525:Atp1a4 UTSW 1 172,067,255 (GRCm39) splice site probably benign
R0615:Atp1a4 UTSW 1 172,059,627 (GRCm39) splice site probably benign
R0730:Atp1a4 UTSW 1 172,067,774 (GRCm39) splice site probably benign
R1412:Atp1a4 UTSW 1 172,059,576 (GRCm39) missense probably damaging 0.97
R1652:Atp1a4 UTSW 1 172,082,470 (GRCm39) missense probably damaging 1.00
R1898:Atp1a4 UTSW 1 172,062,615 (GRCm39) missense probably damaging 0.99
R1968:Atp1a4 UTSW 1 172,067,731 (GRCm39) missense probably benign
R2291:Atp1a4 UTSW 1 172,072,473 (GRCm39) missense probably damaging 1.00
R2897:Atp1a4 UTSW 1 172,074,257 (GRCm39) missense probably damaging 1.00
R2908:Atp1a4 UTSW 1 172,062,044 (GRCm39) missense probably benign
R3119:Atp1a4 UTSW 1 172,067,393 (GRCm39) missense probably damaging 0.99
R3731:Atp1a4 UTSW 1 172,061,528 (GRCm39) missense probably damaging 1.00
R4447:Atp1a4 UTSW 1 172,061,998 (GRCm39) missense probably damaging 0.99
R4602:Atp1a4 UTSW 1 172,067,332 (GRCm39) missense probably damaging 1.00
R4670:Atp1a4 UTSW 1 172,062,567 (GRCm39) missense probably benign 0.07
R4674:Atp1a4 UTSW 1 172,085,223 (GRCm39) missense possibly damaging 0.81
R4675:Atp1a4 UTSW 1 172,085,223 (GRCm39) missense possibly damaging 0.81
R4785:Atp1a4 UTSW 1 172,081,677 (GRCm39) nonsense probably null
R4958:Atp1a4 UTSW 1 172,058,718 (GRCm39) missense probably damaging 1.00
R5015:Atp1a4 UTSW 1 172,081,649 (GRCm39) missense probably damaging 1.00
R5149:Atp1a4 UTSW 1 172,059,572 (GRCm39) missense probably damaging 1.00
R5234:Atp1a4 UTSW 1 172,054,737 (GRCm39) missense possibly damaging 0.73
R5501:Atp1a4 UTSW 1 172,074,399 (GRCm39) missense probably damaging 1.00
R5682:Atp1a4 UTSW 1 172,081,730 (GRCm39) missense probably damaging 0.99
R5872:Atp1a4 UTSW 1 172,071,975 (GRCm39) missense probably damaging 1.00
R5933:Atp1a4 UTSW 1 172,059,841 (GRCm39) missense possibly damaging 0.91
R6722:Atp1a4 UTSW 1 172,085,617 (GRCm39) unclassified probably benign
R7087:Atp1a4 UTSW 1 172,074,269 (GRCm39) missense probably damaging 1.00
R7122:Atp1a4 UTSW 1 172,059,503 (GRCm39) missense possibly damaging 0.47
R7381:Atp1a4 UTSW 1 172,067,682 (GRCm39) missense possibly damaging 0.70
R7431:Atp1a4 UTSW 1 172,078,474 (GRCm39) missense probably benign 0.31
R8269:Atp1a4 UTSW 1 172,059,892 (GRCm39) missense probably damaging 1.00
R8559:Atp1a4 UTSW 1 172,078,897 (GRCm39) missense probably damaging 1.00
R8680:Atp1a4 UTSW 1 172,078,566 (GRCm39) missense probably damaging 1.00
R8777:Atp1a4 UTSW 1 172,059,869 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Atp1a4 UTSW 1 172,059,869 (GRCm39) missense probably damaging 1.00
R8867:Atp1a4 UTSW 1 172,072,491 (GRCm39) missense probably damaging 0.99
R8869:Atp1a4 UTSW 1 172,054,690 (GRCm39) missense probably benign
R9260:Atp1a4 UTSW 1 172,074,359 (GRCm39) missense probably damaging 1.00
R9300:Atp1a4 UTSW 1 172,067,398 (GRCm39) missense probably damaging 1.00
R9545:Atp1a4 UTSW 1 172,078,464 (GRCm39) missense probably benign 0.35
Z1176:Atp1a4 UTSW 1 172,059,521 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GTTCAAGATGGGATTCCCTCC -3'
(R):5'- GTCAATCTGAGGACAGCACAC -3'

Sequencing Primer
(F):5'- AGATGGGATTCCCTCCAGTAC -3'
(R):5'- TCTGAGGACAGCACACACTGG -3'
Posted On 2020-09-02