Mutagenetix > Incidental Mutation

Incidental Mutation 'R8400:Atp1a4'

647797

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8400 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 172234494 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 688 (D688V)

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

AlphaFold

Q9WV27

Predicted Effect

probably damaging
Transcript: ENSMUST00000111243
AA Change: D688V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: D688V

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,293,925	M1929I	probably benign	Het
Abca13	T	C	11: 9,298,218	I2655T	probably damaging	Het
Acad10	A	G	5: 121,626,205	V887A	possibly damaging	Het
Acot10	T	C	15: 20,666,172	E161G	possibly damaging	Het
Astn1	C	T	1: 158,657,100	P919L	probably benign	Het
C4bp	C	A	1: 130,636,747	C400F	probably damaging	Het
Col6a6	A	C	9: 105,774,796	D1005E	probably damaging	Het
Csnk1g3	C	T	18: 53,953,288	R422C	probably benign	Het
Cutc	T	C	19: 43,753,205	S15P	probably benign	Het
Dgkb	T	C	12: 38,602,838		probably null	Het
Disc1	T	C	8: 125,232,993	V748A	probably benign	Het
Dmbt1	C	G	7: 131,082,587	D778E	unknown	Het
Dmxl2	T	C	9: 54,383,753	Y2471C	probably benign	Het
Fam185a	T	A	5: 21,438,816	N243K	probably benign	Het
Fchsd2	A	T	7: 101,253,573	Q386L	possibly damaging	Het
Gm904	C	A	13: 50,643,417	P49Q	probably damaging	Het
H2-Q10	C	T	17: 35,470,477	R59C	probably damaging	Het
Ier5l	A	G	2: 30,473,093	Y307H	possibly damaging	Het
Kmt2e	C	A	5: 23,497,092	T906K	probably benign	Het
Kndc1	C	T	7: 139,913,518	R467W	probably damaging	Het
Muc5ac	C	A	7: 141,810,476	T2508K	probably damaging	Het
Nlrp9a	A	T	7: 26,565,006	M784L	probably benign	Het
Nlrp9b	T	A	7: 20,024,012	C391*	probably null	Het
Nubp2	A	C	17: 24,884,465	M146R	probably damaging	Het
Olfr1295	A	T	2: 111,565,402	L14H	probably damaging	Het
Olfr1359	G	A	13: 21,703,915	V305M	probably benign	Het
Olfr1419	T	A	19: 11,871,214	M1L	probably damaging	Het
Olfr43	C	T	11: 74,206,395	V274M	possibly damaging	Het
Olfr694	T	A	7: 106,689,669	S21C	probably benign	Het
Olfr857	A	T	9: 19,713,093	N89Y	probably benign	Het
Otud1	T	C	2: 19,658,378	V106A	possibly damaging	Het
Pcdhac1	T	A	18: 37,092,400	Y755*	probably null	Het
Pkd1l3	C	T	8: 109,623,888	P455L	possibly damaging	Het
Ptprb	GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	10: 116,283,572		probably benign	Het
Samhd1	T	C	2: 157,099,433	E648G	probably benign	Het
Smarca5	T	C	8: 80,709,127	T794A	probably benign	Het
Spc24	A	T	9: 21,757,730	L87H	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Stra6l	G	A	4: 45,864,905	R77Q	probably damaging	Het
Tdrd1	G	A	19: 56,848,649	V472M	probably benign	Het
Tsc2	A	T	17: 24,604,987	I948K	possibly damaging	Het
Ttc39d	T	C	17: 80,216,005	V31A	probably benign	Het
Vmn1r158	A	T	7: 22,789,880	C301*	probably null	Het
Vmn2r22	A	T	6: 123,637,527	L368*	probably null	Het
Vmn2r79	A	G	7: 87,002,100	T236A	probably benign	Het
Vwa1	T	C	4: 155,772,768	H191R	probably benign	Het
Zdbf2	T	A	1: 63,304,976	V838E	possibly damaging	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GTTCAAGATGGGATTCCCTCC -3'
(R):5'- GTCAATCTGAGGACAGCACAC -3'

Sequencing Primer
(F):5'- AGATGGGATTCCCTCCAGTAC -3'
(R):5'- TCTGAGGACAGCACACACTGG -3'

Posted On

2020-09-02