Incidental Mutation 'R8400:Samhd1'
ID 647801
Institutional Source Beutler Lab
Gene Symbol Samhd1
Ensembl Gene ENSMUSG00000027639
Gene Name SAM domain and HD domain, 1
Synonyms E330031J07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 157097533-157135265 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 157099433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 648 (E648G)
Ref Sequence ENSEMBL: ENSMUSP00000059717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057725] [ENSMUST00000088523] [ENSMUST00000099140] [ENSMUST00000109549] [ENSMUST00000123932] [ENSMUST00000166140]
AlphaFold Q60710
Predicted Effect probably benign
Transcript: ENSMUST00000057725
AA Change: E648G

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000059717
Gene: ENSMUSG00000027639
AA Change: E648G

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088523
SMART Domains Protein: ENSMUSP00000085880
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 2e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099140
SMART Domains Protein: ENSMUSP00000096743
Gene: ENSMUSG00000074628

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
TLDc 36 198 8.47e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109549
SMART Domains Protein: ENSMUSP00000105176
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123932
SMART Domains Protein: ENSMUSP00000124599
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SAM 43 112 1.51e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139263
SMART Domains Protein: ENSMUSP00000124935
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
SAM 54 122 4.4e-14 SMART
HDc 172 337 1.89e-9 SMART
Blast:HDc 378 417 2e-16 BLAST
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166140
SMART Domains Protein: ENSMUSP00000129278
Gene: ENSMUSG00000074628

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
TLDc 50 212 8.47e-58 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in regulation of the innate immune response. The encoded protein is upregulated in response to viral infection and may be involved in mediation of tumor necrosis factor-alpha proinflammatory responses. Mutations in this gene have been associated with Aicardi-Goutieres syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to infection with pseudotyped HIV-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in Samhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Samhd1 APN 2 157120548 missense probably damaging 1.00
IGL00903:Samhd1 APN 2 157107423 splice site probably benign
IGL01313:Samhd1 APN 2 157116401 missense probably damaging 1.00
IGL01775:Samhd1 APN 2 157114330 splice site probably benign
IGL02245:Samhd1 APN 2 157110555 missense possibly damaging 0.46
IGL02314:Samhd1 APN 2 157135028 missense probably damaging 0.98
R0390:Samhd1 UTSW 2 157114231 missense probably damaging 1.00
R0487:Samhd1 UTSW 2 157110615 missense probably damaging 1.00
R0842:Samhd1 UTSW 2 157123331 missense probably damaging 0.99
R1199:Samhd1 UTSW 2 157109461 missense probably damaging 0.99
R1681:Samhd1 UTSW 2 157101732 missense probably benign 0.45
R1775:Samhd1 UTSW 2 157107547 missense probably benign 0.16
R2859:Samhd1 UTSW 2 157106229 critical splice donor site probably null
R2903:Samhd1 UTSW 2 157123415 missense possibly damaging 0.95
R2905:Samhd1 UTSW 2 157123415 missense possibly damaging 0.95
R3983:Samhd1 UTSW 2 157123449 missense possibly damaging 0.81
R4432:Samhd1 UTSW 2 157104893 missense probably damaging 0.99
R4576:Samhd1 UTSW 2 157101750 missense probably damaging 1.00
R5283:Samhd1 UTSW 2 157109492 missense possibly damaging 0.70
R5741:Samhd1 UTSW 2 157112831 missense probably benign
R6021:Samhd1 UTSW 2 157120554 critical splice acceptor site probably null
R6518:Samhd1 UTSW 2 157114297 missense possibly damaging 0.62
R6818:Samhd1 UTSW 2 157107497 missense probably benign 0.04
R6924:Samhd1 UTSW 2 157109483 missense probably benign 0.00
R7307:Samhd1 UTSW 2 157135020 missense probably benign 0.27
R7337:Samhd1 UTSW 2 157106244 missense probably damaging 0.99
R7596:Samhd1 UTSW 2 157101834 missense probably damaging 1.00
R7892:Samhd1 UTSW 2 157116495 missense probably damaging 1.00
R8081:Samhd1 UTSW 2 157101438 nonsense probably null
R8234:Samhd1 UTSW 2 157116350 critical splice donor site probably null
R8690:Samhd1 UTSW 2 157129874 missense probably benign 0.00
R9090:Samhd1 UTSW 2 157114285 missense probably damaging 1.00
R9271:Samhd1 UTSW 2 157114285 missense probably damaging 1.00
R9765:Samhd1 UTSW 2 157123299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGAATGAAAACGAGACCCC -3'
(R):5'- GTACAGCTTTGAATTTCTCAAGAGG -3'

Sequencing Primer
(F):5'- CCCCACCCCAGCACGAG -3'
(R):5'- CAATCTATGTTCAGGACAGAGGTGTG -3'
Posted On 2020-09-02