Incidental Mutation 'R8400:Samhd1'
ID 647801
Institutional Source Beutler Lab
Gene Symbol Samhd1
Ensembl Gene ENSMUSG00000027639
Gene Name SAM domain and HD domain, 1
Synonyms E330031J07Rik
MMRRC Submission 067763-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 156939454-156977016 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 156941353 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 648 (E648G)
Ref Sequence ENSEMBL: ENSMUSP00000059717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057725] [ENSMUST00000088523] [ENSMUST00000099140] [ENSMUST00000109549] [ENSMUST00000123932] [ENSMUST00000166140]
AlphaFold Q60710
Predicted Effect probably benign
Transcript: ENSMUST00000057725
AA Change: E648G

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000059717
Gene: ENSMUSG00000027639
AA Change: E648G

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088523
SMART Domains Protein: ENSMUSP00000085880
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 2e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099140
SMART Domains Protein: ENSMUSP00000096743
Gene: ENSMUSG00000074628

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
TLDc 36 198 8.47e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109549
SMART Domains Protein: ENSMUSP00000105176
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123932
SMART Domains Protein: ENSMUSP00000124599
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SAM 43 112 1.51e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139263
SMART Domains Protein: ENSMUSP00000124935
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
SAM 54 122 4.4e-14 SMART
HDc 172 337 1.89e-9 SMART
Blast:HDc 378 417 2e-16 BLAST
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166140
SMART Domains Protein: ENSMUSP00000129278
Gene: ENSMUSG00000074628

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
TLDc 50 212 8.47e-58 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in regulation of the innate immune response. The encoded protein is upregulated in response to viral infection and may be involved in mediation of tumor necrosis factor-alpha proinflammatory responses. Mutations in this gene have been associated with Aicardi-Goutieres syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to infection with pseudotyped HIV-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,243,925 (GRCm39) M1929I probably benign Het
Abca13 T C 11: 9,248,218 (GRCm39) I2655T probably damaging Het
Acad10 A G 5: 121,764,268 (GRCm39) V887A possibly damaging Het
Acot10 T C 15: 20,666,258 (GRCm39) E161G possibly damaging Het
Astn1 C T 1: 158,484,670 (GRCm39) P919L probably benign Het
Atp1a4 T A 1: 172,062,061 (GRCm39) D688V probably damaging Het
C4bp C A 1: 130,564,484 (GRCm39) C400F probably damaging Het
Col6a6 A C 9: 105,651,995 (GRCm39) D1005E probably damaging Het
Csnk1g3 C T 18: 54,086,360 (GRCm39) R422C probably benign Het
Cutc T C 19: 43,741,644 (GRCm39) S15P probably benign Het
Dgkb T C 12: 38,652,837 (GRCm39) probably null Het
Disc1 T C 8: 125,959,732 (GRCm39) V748A probably benign Het
Dmbt1 C G 7: 130,684,317 (GRCm39) D778E unknown Het
Dmxl2 T C 9: 54,291,037 (GRCm39) Y2471C probably benign Het
Fam185a T A 5: 21,643,814 (GRCm39) N243K probably benign Het
Fchsd2 A T 7: 100,902,780 (GRCm39) Q386L possibly damaging Het
Gm904 C A 13: 50,797,453 (GRCm39) P49Q probably damaging Het
H2-Q10 C T 17: 35,781,374 (GRCm39) R59C probably damaging Het
Ier5l A G 2: 30,363,105 (GRCm39) Y307H possibly damaging Het
Kmt2e C A 5: 23,702,090 (GRCm39) T906K probably benign Het
Kndc1 C T 7: 139,493,434 (GRCm39) R467W probably damaging Het
Muc5ac C A 7: 141,364,213 (GRCm39) T2508K probably damaging Het
Nlrp9a A T 7: 26,264,431 (GRCm39) M784L probably benign Het
Nlrp9b T A 7: 19,757,937 (GRCm39) C391* probably null Het
Nubp2 A C 17: 25,103,439 (GRCm39) M146R probably damaging Het
Or10q3 T A 19: 11,848,578 (GRCm39) M1L probably damaging Het
Or1a1b C T 11: 74,097,221 (GRCm39) V274M possibly damaging Het
Or2ag1b T A 7: 106,288,876 (GRCm39) S21C probably benign Het
Or2b2 G A 13: 21,888,085 (GRCm39) V305M probably benign Het
Or4k45 A T 2: 111,395,747 (GRCm39) L14H probably damaging Het
Or7e166 A T 9: 19,624,389 (GRCm39) N89Y probably benign Het
Otud1 T C 2: 19,663,189 (GRCm39) V106A possibly damaging Het
Pcdhac1 T A 18: 37,225,453 (GRCm39) Y755* probably null Het
Pkd1l3 C T 8: 110,350,520 (GRCm39) P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,119,477 (GRCm39) probably benign Het
Smarca5 T C 8: 81,435,756 (GRCm39) T794A probably benign Het
Spc24 A T 9: 21,669,026 (GRCm39) L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stra6l G A 4: 45,864,905 (GRCm39) R77Q probably damaging Het
Tdrd1 G A 19: 56,837,081 (GRCm39) V472M probably benign Het
Tsc2 A T 17: 24,823,961 (GRCm39) I948K possibly damaging Het
Ttc39d T C 17: 80,523,434 (GRCm39) V31A probably benign Het
Vmn1r158 A T 7: 22,489,305 (GRCm39) C301* probably null Het
Vmn2r22 A T 6: 123,614,486 (GRCm39) L368* probably null Het
Vmn2r79 A G 7: 86,651,308 (GRCm39) T236A probably benign Het
Vwa1 T C 4: 155,857,225 (GRCm39) H191R probably benign Het
Zdbf2 T A 1: 63,344,135 (GRCm39) V838E possibly damaging Het
Other mutations in Samhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Samhd1 APN 2 156,962,468 (GRCm39) missense probably damaging 1.00
IGL00903:Samhd1 APN 2 156,949,343 (GRCm39) splice site probably benign
IGL01313:Samhd1 APN 2 156,958,321 (GRCm39) missense probably damaging 1.00
IGL01775:Samhd1 APN 2 156,956,250 (GRCm39) splice site probably benign
IGL02245:Samhd1 APN 2 156,952,475 (GRCm39) missense possibly damaging 0.46
IGL02314:Samhd1 APN 2 156,976,948 (GRCm39) missense probably damaging 0.98
R0390:Samhd1 UTSW 2 156,956,151 (GRCm39) missense probably damaging 1.00
R0487:Samhd1 UTSW 2 156,952,535 (GRCm39) missense probably damaging 1.00
R0842:Samhd1 UTSW 2 156,965,251 (GRCm39) missense probably damaging 0.99
R1199:Samhd1 UTSW 2 156,951,381 (GRCm39) missense probably damaging 0.99
R1681:Samhd1 UTSW 2 156,943,652 (GRCm39) missense probably benign 0.45
R1775:Samhd1 UTSW 2 156,949,467 (GRCm39) missense probably benign 0.16
R2859:Samhd1 UTSW 2 156,948,149 (GRCm39) critical splice donor site probably null
R2903:Samhd1 UTSW 2 156,965,335 (GRCm39) missense possibly damaging 0.95
R2905:Samhd1 UTSW 2 156,965,335 (GRCm39) missense possibly damaging 0.95
R3983:Samhd1 UTSW 2 156,965,369 (GRCm39) missense possibly damaging 0.81
R4432:Samhd1 UTSW 2 156,946,813 (GRCm39) missense probably damaging 0.99
R4576:Samhd1 UTSW 2 156,943,670 (GRCm39) missense probably damaging 1.00
R5283:Samhd1 UTSW 2 156,951,412 (GRCm39) missense possibly damaging 0.70
R5741:Samhd1 UTSW 2 156,954,751 (GRCm39) missense probably benign
R6021:Samhd1 UTSW 2 156,962,474 (GRCm39) critical splice acceptor site probably null
R6518:Samhd1 UTSW 2 156,956,217 (GRCm39) missense possibly damaging 0.62
R6818:Samhd1 UTSW 2 156,949,417 (GRCm39) missense probably benign 0.04
R6924:Samhd1 UTSW 2 156,951,403 (GRCm39) missense probably benign 0.00
R7307:Samhd1 UTSW 2 156,976,940 (GRCm39) missense probably benign 0.27
R7337:Samhd1 UTSW 2 156,948,164 (GRCm39) missense probably damaging 0.99
R7596:Samhd1 UTSW 2 156,943,754 (GRCm39) missense probably damaging 1.00
R7892:Samhd1 UTSW 2 156,958,415 (GRCm39) missense probably damaging 1.00
R8081:Samhd1 UTSW 2 156,943,358 (GRCm39) nonsense probably null
R8234:Samhd1 UTSW 2 156,958,270 (GRCm39) critical splice donor site probably null
R8690:Samhd1 UTSW 2 156,971,794 (GRCm39) missense probably benign 0.00
R9090:Samhd1 UTSW 2 156,956,205 (GRCm39) missense probably damaging 1.00
R9271:Samhd1 UTSW 2 156,956,205 (GRCm39) missense probably damaging 1.00
R9765:Samhd1 UTSW 2 156,965,219 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGAATGAAAACGAGACCCC -3'
(R):5'- GTACAGCTTTGAATTTCTCAAGAGG -3'

Sequencing Primer
(F):5'- CCCCACCCCAGCACGAG -3'
(R):5'- CAATCTATGTTCAGGACAGAGGTGTG -3'
Posted On 2020-09-02