Incidental Mutation 'R8400:Stra6l'
ID 647802
Institutional Source Beutler Lab
Gene Symbol Stra6l
Ensembl Gene ENSMUSG00000028327
Gene Name STRA6-like
Synonyms Rbpr2, 1300002K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 45848664-45887008 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 45864905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 77 (R77Q)
Ref Sequence ENSEMBL: ENSMUSP00000030011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030011] [ENSMUST00000107782] [ENSMUST00000107783]
AlphaFold Q9DBN1
Predicted Effect probably damaging
Transcript: ENSMUST00000030011
AA Change: R77Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030011
Gene: ENSMUSG00000028327
AA Change: R77Q

DomainStartEndE-ValueType
Pfam:RBP_receptor 13 602 8.7e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107782
SMART Domains Protein: ENSMUSP00000103411
Gene: ENSMUSG00000028327

DomainStartEndE-ValueType
Pfam:RBP_receptor 1 512 2.8e-221 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107783
AA Change: R77Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103412
Gene: ENSMUSG00000028327
AA Change: R77Q

DomainStartEndE-ValueType
Pfam:RBP_receptor 12 603 1e-254 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in Stra6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Stra6l APN 4 45864864 splice site probably null
IGL02343:Stra6l APN 4 45869588 missense probably damaging 0.99
IGL02710:Stra6l APN 4 45882728 missense possibly damaging 0.72
IGL02880:Stra6l APN 4 45885278 missense possibly damaging 0.70
IGL03034:Stra6l APN 4 45885392 missense probably benign 0.41
IGL03163:Stra6l APN 4 45881455 missense probably benign 0.03
IGL03355:Stra6l APN 4 45873689 missense probably benign 0.16
K2124:Stra6l UTSW 4 45870770 splice site probably benign
R0800:Stra6l UTSW 4 45882797 missense probably benign 0.29
R1171:Stra6l UTSW 4 45864982 missense probably benign
R1931:Stra6l UTSW 4 45882698 nonsense probably null
R1982:Stra6l UTSW 4 45867237 nonsense probably null
R2331:Stra6l UTSW 4 45858224 critical splice donor site probably null
R4691:Stra6l UTSW 4 45882851 missense probably benign 0.39
R4846:Stra6l UTSW 4 45873682 missense possibly damaging 0.76
R5175:Stra6l UTSW 4 45870860 missense probably benign 0.01
R5633:Stra6l UTSW 4 45881455 missense probably benign 0.00
R6212:Stra6l UTSW 4 45884664 missense probably benign
R6517:Stra6l UTSW 4 45879473 missense probably benign
R6534:Stra6l UTSW 4 45860041 splice site probably null
R6584:Stra6l UTSW 4 45869635 splice site probably null
R7763:Stra6l UTSW 4 45869570 nonsense probably null
R8511:Stra6l UTSW 4 45885347 missense probably benign 0.00
R9007:Stra6l UTSW 4 45864910 missense possibly damaging 0.81
R9313:Stra6l UTSW 4 45881454 missense probably benign
R9379:Stra6l UTSW 4 45849093 missense probably benign
R9400:Stra6l UTSW 4 45885293 missense probably damaging 1.00
R9764:Stra6l UTSW 4 45884602 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATCTGTGCTTAGCAGTGTGC -3'
(R):5'- TGACCTTGGGCAAGTAACAGG -3'

Sequencing Primer
(F):5'- CAGTGTGCTTAGACTGTGATTGCAG -3'
(R):5'- ATGTTGTTTTAGCCCTCCAGACAAC -3'
Posted On 2020-09-02