Incidental Mutation 'R8400:Vmn2r22'
ID 647807
Institutional Source Beutler Lab
Gene Symbol Vmn2r22
Ensembl Gene ENSMUSG00000095486
Gene Name vomeronasal 2, receptor 22
Synonyms EG546913
MMRRC Submission 067763-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 123586717-123627594 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 123614486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 368 (L368*)
Ref Sequence ENSEMBL: ENSMUSP00000132043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170808]
AlphaFold E9Q7S8
Predicted Effect probably null
Transcript: ENSMUST00000170808
AA Change: L368*
SMART Domains Protein: ENSMUSP00000132043
Gene: ENSMUSG00000095486
AA Change: L368*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:ANF_receptor 81 473 1.4e-32 PFAM
Pfam:NCD3G 517 570 2.2e-23 PFAM
Pfam:7tm_3 601 838 1.2e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,243,925 (GRCm39) M1929I probably benign Het
Abca13 T C 11: 9,248,218 (GRCm39) I2655T probably damaging Het
Acad10 A G 5: 121,764,268 (GRCm39) V887A possibly damaging Het
Acot10 T C 15: 20,666,258 (GRCm39) E161G possibly damaging Het
Astn1 C T 1: 158,484,670 (GRCm39) P919L probably benign Het
Atp1a4 T A 1: 172,062,061 (GRCm39) D688V probably damaging Het
C4bp C A 1: 130,564,484 (GRCm39) C400F probably damaging Het
Col6a6 A C 9: 105,651,995 (GRCm39) D1005E probably damaging Het
Csnk1g3 C T 18: 54,086,360 (GRCm39) R422C probably benign Het
Cutc T C 19: 43,741,644 (GRCm39) S15P probably benign Het
Dgkb T C 12: 38,652,837 (GRCm39) probably null Het
Disc1 T C 8: 125,959,732 (GRCm39) V748A probably benign Het
Dmbt1 C G 7: 130,684,317 (GRCm39) D778E unknown Het
Dmxl2 T C 9: 54,291,037 (GRCm39) Y2471C probably benign Het
Fam185a T A 5: 21,643,814 (GRCm39) N243K probably benign Het
Fchsd2 A T 7: 100,902,780 (GRCm39) Q386L possibly damaging Het
Gm904 C A 13: 50,797,453 (GRCm39) P49Q probably damaging Het
H2-Q10 C T 17: 35,781,374 (GRCm39) R59C probably damaging Het
Ier5l A G 2: 30,363,105 (GRCm39) Y307H possibly damaging Het
Kmt2e C A 5: 23,702,090 (GRCm39) T906K probably benign Het
Kndc1 C T 7: 139,493,434 (GRCm39) R467W probably damaging Het
Muc5ac C A 7: 141,364,213 (GRCm39) T2508K probably damaging Het
Nlrp9a A T 7: 26,264,431 (GRCm39) M784L probably benign Het
Nlrp9b T A 7: 19,757,937 (GRCm39) C391* probably null Het
Nubp2 A C 17: 25,103,439 (GRCm39) M146R probably damaging Het
Or10q3 T A 19: 11,848,578 (GRCm39) M1L probably damaging Het
Or1a1b C T 11: 74,097,221 (GRCm39) V274M possibly damaging Het
Or2ag1b T A 7: 106,288,876 (GRCm39) S21C probably benign Het
Or2b2 G A 13: 21,888,085 (GRCm39) V305M probably benign Het
Or4k45 A T 2: 111,395,747 (GRCm39) L14H probably damaging Het
Or7e166 A T 9: 19,624,389 (GRCm39) N89Y probably benign Het
Otud1 T C 2: 19,663,189 (GRCm39) V106A possibly damaging Het
Pcdhac1 T A 18: 37,225,453 (GRCm39) Y755* probably null Het
Pkd1l3 C T 8: 110,350,520 (GRCm39) P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,119,477 (GRCm39) probably benign Het
Samhd1 T C 2: 156,941,353 (GRCm39) E648G probably benign Het
Smarca5 T C 8: 81,435,756 (GRCm39) T794A probably benign Het
Spc24 A T 9: 21,669,026 (GRCm39) L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,701,903 (GRCm39) probably null Het
Stra6l G A 4: 45,864,905 (GRCm39) R77Q probably damaging Het
Tdrd1 G A 19: 56,837,081 (GRCm39) V472M probably benign Het
Tsc2 A T 17: 24,823,961 (GRCm39) I948K possibly damaging Het
Ttc39d T C 17: 80,523,434 (GRCm39) V31A probably benign Het
Vmn1r158 A T 7: 22,489,305 (GRCm39) C301* probably null Het
Vmn2r79 A G 7: 86,651,308 (GRCm39) T236A probably benign Het
Vwa1 T C 4: 155,857,225 (GRCm39) H191R probably benign Het
Zdbf2 T A 1: 63,344,135 (GRCm39) V838E possibly damaging Het
Other mutations in Vmn2r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r22 APN 6 123,615,012 (GRCm39) missense probably damaging 1.00
IGL01764:Vmn2r22 APN 6 123,627,379 (GRCm39) critical splice donor site probably null
IGL02037:Vmn2r22 APN 6 123,626,026 (GRCm39) missense probably damaging 1.00
IGL02183:Vmn2r22 APN 6 123,614,963 (GRCm39) missense probably damaging 1.00
IGL02335:Vmn2r22 APN 6 123,615,051 (GRCm39) missense probably damaging 0.99
IGL02440:Vmn2r22 APN 6 123,614,364 (GRCm39) missense probably benign 0.00
IGL02663:Vmn2r22 APN 6 123,626,117 (GRCm39) missense probably benign 0.11
IGL03101:Vmn2r22 APN 6 123,614,295 (GRCm39) missense probably benign 0.09
R0266:Vmn2r22 UTSW 6 123,614,363 (GRCm39) missense probably damaging 0.99
R0348:Vmn2r22 UTSW 6 123,614,684 (GRCm39) missense probably damaging 1.00
R0780:Vmn2r22 UTSW 6 123,614,933 (GRCm39) missense probably damaging 1.00
R0849:Vmn2r22 UTSW 6 123,614,363 (GRCm39) missense probably damaging 0.99
R1074:Vmn2r22 UTSW 6 123,626,217 (GRCm39) missense probably benign 0.02
R1456:Vmn2r22 UTSW 6 123,614,624 (GRCm39) missense possibly damaging 0.86
R1719:Vmn2r22 UTSW 6 123,614,802 (GRCm39) missense possibly damaging 0.68
R1989:Vmn2r22 UTSW 6 123,614,500 (GRCm39) missense probably damaging 1.00
R2928:Vmn2r22 UTSW 6 123,614,402 (GRCm39) missense probably damaging 0.96
R2939:Vmn2r22 UTSW 6 123,614,594 (GRCm39) missense probably damaging 0.99
R3727:Vmn2r22 UTSW 6 123,627,584 (GRCm39) missense possibly damaging 0.70
R3782:Vmn2r22 UTSW 6 123,627,591 (GRCm39) nonsense probably null
R3873:Vmn2r22 UTSW 6 123,614,339 (GRCm39) missense possibly damaging 0.68
R4344:Vmn2r22 UTSW 6 123,614,756 (GRCm39) missense probably damaging 1.00
R4407:Vmn2r22 UTSW 6 123,614,913 (GRCm39) missense probably damaging 1.00
R4428:Vmn2r22 UTSW 6 123,614,817 (GRCm39) missense possibly damaging 0.47
R4430:Vmn2r22 UTSW 6 123,614,817 (GRCm39) missense possibly damaging 0.47
R4431:Vmn2r22 UTSW 6 123,614,817 (GRCm39) missense possibly damaging 0.47
R4701:Vmn2r22 UTSW 6 123,627,428 (GRCm39) missense probably benign 0.00
R5274:Vmn2r22 UTSW 6 123,627,593 (GRCm39) start codon destroyed probably null 0.93
R5668:Vmn2r22 UTSW 6 123,614,873 (GRCm39) missense probably benign 0.06
R5776:Vmn2r22 UTSW 6 123,614,673 (GRCm39) missense probably damaging 1.00
R6416:Vmn2r22 UTSW 6 123,614,697 (GRCm39) missense probably damaging 1.00
R7788:Vmn2r22 UTSW 6 123,614,559 (GRCm39) missense not run
R8208:Vmn2r22 UTSW 6 123,614,444 (GRCm39) missense probably damaging 1.00
R8267:Vmn2r22 UTSW 6 123,615,000 (GRCm39) missense possibly damaging 0.81
R8814:Vmn2r22 UTSW 6 123,614,789 (GRCm39) missense probably damaging 0.96
R8850:Vmn2r22 UTSW 6 123,614,454 (GRCm39) missense probably damaging 1.00
R9613:Vmn2r22 UTSW 6 123,615,075 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTTCTATCCAGTGAGCC -3'
(R):5'- TCTGGATCACAACTTCTGATTGG -3'

Sequencing Primer
(F):5'- CTCCTTCCACTCTGAGGGACAG -3'
(R):5'- GGATCACAACTTCTGATTGGGATATC -3'
Posted On 2020-09-02